Zygophyllum fabago
speciesAt a glance
Occurrence records4 462
Data sources11
Biological traits29
DNA specimens42
eDNA detections17
Sources11 archives
Databases and archives Zygophyllum fabago's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 462 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics42 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources29 traits
Chemical compositionLOTUS8 compounds
Occurrence & distributionGBIF4 462 records
Environmental DNA1 datasets · 4 countries17 detections
DNA & barcodingBOLD · NCBI42 specimens
Genome at a glanceCCDB2n = 22
01Narrative
Zygophyllum fabago est une espèce de plante de la famille des Zygophyllaceae et du genre Zygophyllum.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology7
Leaf size138 mm²
Plant height0.231 m
Plant height max0.8 m
Plant height min0.3 m
Seed mass3.9 mg
Seed mass max5.8 mg
Seed mass min2.09 mg
Life cycle & reproduction6
Deciduousnessdeciduous
Flowering endJun
Flowering startApr
Life formperennial
Life spanperennial
Lifeform raunkiaer detailedhemicryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 400 m
Elevation min300 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTdesert,dump,hills,parks
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)163 mg/g
Leaf n13.0 mg/g
Leaf p1.92 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)5.8 mm²/mg
03Chemical composition8 compounds
Compounds documented for Zygophyllum fabago across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Ursane and Taraxastane triterpenoids6
Oleanane triterpenoids2
Documented compounds8 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,2R,4aS,6aR,6aR,6bR,8aR,10S,12aR,14bS)-10-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-methyl-3-sulfooxyoxan-2-yl]oxy-1,2,6b,9,9,12a-hexamethyl-4a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-6a-carboxylic acid | present | LOTUS | |
| (1S,2R,4aS,6aR,6bR,8aR,10S,12aR,12bR,14bS)-1,2,6b,9,9,12a-hexamethyl-10-((2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydro-2H-pyran-2-yloxy)-4a-(((2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)tetrahydro-2H-pyran-2-yloxy)carbonyl)-1,2,3,4,4a,5,6,6a,6b,7,8,8a,9,10,11,12,12a,12b,13,14b-icosahydropicene-6a-carboxylic acid | present | LOTUS | |
| [(3S,4S,4aR,6aR,6aR,6bR,8aR,12R,12aS,14aR,14bR)-8a-(hydroxymethyl)-4,6a,6b,12,14b-pentamethyl-11-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxy-2,3,4a,5,6,6a,7,8,9,12,12a,13,14,14a-tetradecahydro-1H-picen-4-yl]methyl hydrogen sulfate | present | LOTUS | |
| [(3S,4S,4aR,6aR,6aR,6bR,8aR,12R,12aS,14aR,14bR)-8a-(hydroxymethyl)-4,6a,6b,12,14b-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-11-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-2,3,4a,5,6,6a,7,8,9,12,12a,13,14,14a-tetradecahydro-1H-picen-4-yl]methyl hydrogen sulfate | present | LOTUS | |
| [8a-(hydroxymethyl)-4,6a,6b,12,14b-pentamethyl-11-[[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-3-(3,4,5-trihydroxyoxan-2-yl)oxy-2,3,4a,5,6,6a,7,8,9,12,12a,13,14,14a-tetradecahydro-1H-picen-4-yl]methyl hydrogen sulfate | present | LOTUS | |
| [8a-(hydroxymethyl)-4,6a,6b,12,14b-pentamethyl-3-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-11-[[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-2,3,4a,5,6,6a,7,8,9,12,12a,13,14,14a-tetradecahydro-1H-picen-4-yl]methyl hydrogen sulfate | present | LOTUS | |
| Zygophyloside O | present | LOTUS | |
| Zygophyloside P | present | LOTUS |
05DNA & barcoding42 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Zygophyllum fabago has left across the world's sequence archives.
At a glance
DNA specimens42
Marker genes7
GenBank sequences10
eDNA detections17
Countries6
The DNA barcodea real sequence read deposited for this species
CGCAACGTCGCCCCCACCCCATCCATAATGGGAGGGTGCGTATGATGGCCTCCCGTGAGCTACCATTTGCGGTTGGCCTAAACACGAGTC …
Zygophyllum fabago voucher WW-63 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL1★rbcLa★ITS8★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Zygophyllum fabago carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidydiploid inferred
Chromosome records18–282n range22median22mode18records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2215×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +4
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — IOPB. Chromosome data 7 (ed. A. Stace). Diosdado, J. C. & al.Intern. Organ. Plant Biosyst.22: 3-4(1994).
CCDB · ipcn-api-dl — Diosdado, J. C., J. Vioque, R. Juan & J. Pastor. 1994. IOPB chromosome data 7. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 22: 3–4.
CCDB · ipcn-api-dl — Daniela, I. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 13–14.
CCDB · ipcn-api-dl — Hilu, K. W. 1979. In IOPB chromosome number reports LXIV. Taxon 28:395.
CCDB · ipcn-api-dl — Magulaev, A. J. 1979a. The chromosome numbers of flowering plants in the Northern Caucasus. Part 3. Flora of the North Caucasus and questions of its history,. 3: 101–106.
CCDB · ipcn-api-dl — Gadnidze, R. I., T. N. Gviniashvili, I. M. Danelia & M. V. Churadze. 1998. Chromosome numbers of the species of the Georgian flora. Bot. Žhurn. (Moscow & Leningrad) 83(10): 143–147.
CCDB · book-ipcn75-78 — Kliphuis & Barkoudah 1977
CCDB · book-fedorov — Warburg 1938b
CCDB · book-atlas-flowering-plants — Warburg 1938
CCDB · CromoCat 2015 — Daniela, I. (1997). IOPB Chromosome Data 11 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 26-27: 13-14.
CCDB · CromoCat 2015 — Diosdado, J. C., Vioque, J., Juan, R. & Pastor, J. E. (1994). IOPB Chromosome Data 7 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 22: 3-4.
CCDB · CromoCat 2015 — Hilu, K. W. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 395.
CCDB · CromoCat 2015 — Koeva-Todorovska, J. T. & Ugareinska, P. (1982). Kariologicno proucvane na predstavitelite ot sem. Zygophyllaceae v Balgarija. God. Sof. Univ. Biol. Fak. 72-73(2): 5-9.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
2n 282×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Tarnavschi, I. T. & I. LUNGEANU. 1982. Bemerkungen über einige Chromosomenzahlen wildwachsender Arten aus Rumänien. Lucr. Grăd. Bot Bucures|7ti 1981–1982: 17–20.
CCDB · CromoCat 2015 — Tarnavschi, I. T. & I. Lungeanu. (1982). Bemerkungen über einige chromosomenzahlen wildwachsender arten aus Rumänien. Acta Bot. Horti Bucures 1981: 17-20.
2n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tarnavschi, I. T. & I. Lungeanu. (1982). Bemerkungen über einige chromosomenzahlen wildwachsender arten aus Rumänien. Acta Bot. Horti Bucures 1981: 17-20.
n 115×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 619-630. Ruz de Clavijo Jimnez, E.Anales Jard. Bot. Madrid47(2): 431-437(1990).
CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1990. Números cromosomáticos de plantas occidentales, 619--630. Anales Jard. Bot. Madrid 47: 431–437.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1990a). Números cromosomáticos de plantas occidentales, 619-630. Anales Jard. Bot. Madrid 47(2): 431-437.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 462 records
Wild obs. + sensor3 708
Museum / vouchered732
Cultivated / captive6
Other16
Origin
Native232
Introduced8
Range
Area of Occupancy AOO7 360 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy87% within 1 km
≤100 m 1 733≤1 km 451≤10 km 297>10 km 40
2 521 georeferenced · 1 187 without coordinates
Open the mapobservation + sensor3 708
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 31≤1 km 108≤10 km 122>10 km 15
276 georeferenced · 456 without coordinates
Open the institutions mapphysical evidence732
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 4
4 georeferenced · 2 without coordinates
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions52 of 97 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 104 |
| MAlocation not on record | 52 |
| BClocation not on record | 35 |
| Beijing, CN | 34 |
| València, ES | 33 |
| Barcelona, ES | 28 |
| Yangling, CN | 22 |
| Urumqi, CN | 22 |
| Jiangxi College of Educationlocation not on record | 15 |
| Granada, ES | 14 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 14 |
| Wlocation not on record | 13 |
| BDBClocation not on record | 13 |
| Bronx, US | 12 |
| Salamanca, ES | 12 |
| Phyletisches Museum Jenalocation not on record | 12 |
| Entomological Society of Latvialocation not on record | 10 |
| GMBAlocation not on record | 10 |
| Herbarium of South China Botanical Gardenlocation not on record | 8 |
| Shanxi Universitylocation not on record | 8 |
| College of the Atlantic, Museumlocation not on record | 7 |
| Alicante, ES | 6 |
| Badajoz, ES | 6 |
| Pullman, US | 6 |
| EEZA-CSIClocation not on record | 6 |
| Riverside, US | 5 |
| IDElocation not on record | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| Guangzhou, CN | 5 |
| Berlin, DE | 5 |
| BRNUlocation not on record | 5 |
| Vitoria, ES | 5 |
| WTUlocation not on record | 4 |
| Logan, US | 4 |
| Urumqi, CN | 4 |
| Paris, FR | 4 |
| WNNUlocation not on record | 4 |
| Madrid, ES | 4 |
| Davis, US | 4 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| UIBlocation not on record | 3 |
| Edinburgh, GB | 3 |
| Uniwersytet Jagiellońskilocation not on record | 3 |
| CICYTEXlocation not on record | 3 |
| Beijing Normal Universitylocation not on record | 3 |
| Uniwersytet Warszawskilocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| GZUlocation not on record | 3 |
| South Kensington, GB | 3 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 3 |
| EL PASO, US | 3 |
| Henry Brockhouse Collectionlocation not on record | 2 |
| Nanjing, CN | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Bratislava, SK | 2 |
| Albuquerque, US | 2 |
| Pamplona, ES | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Bozeman, US | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Claremont, US | 2 |
| Kunming, CN | 2 |
| Moscow, US | 2 |
| Northridge, US | 1 |
| INTAlocation not on record | 1 |
| Turlock, US | 1 |
| Kew, GB | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| San Angelo, US | 1 |
| Bourges, FR | 1 |
| Sevilla, ES | 1 |
| Macomb, US | 1 |
| ARM059location not on record | 1 |
| ASUlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Fort Worth, US | 1 |
| Phoenix, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Saint Louis, US | 1 |
| Wuzhou, CN | 1 |
| Henderson, US | 1 |
| Mexico City, MX | 1 |
| Frankfurt am Main | 1 |
| Stockholm, SE | 1 |
| Oskarshamn, SE | 1 |
| JBCLMlocation not on record | 1 |
| Boise, US | 1 |
| Minia, EG | 1 |
| Flagstaff, US | 1 |
| Chongqing Museumlocation not on record | 1 |
| Cheney, US | 1 |
97 institutions · 664 of 732 vouchered records shown · 68 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Zygophyllum fabago was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map4 countries0
Desert hillside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.10 °C -0.5–25.2
Seasonal swing summer↔winter37.1 °C
Max temp (day)14.5 °C 4.60–31.1
Min temp (night)1.10 °C -7.00–17.9
Precipitation29.6 mm/mo 11.7–81.9
Air humidity50.7 % 41.7–60.6
Moisture balance-63.9 mm/mo -150–0.3
Vapour deficit537 Pa 285–1,883
Wind speed2.90 m/s 2.10–5.30
Cloud cover39.5 % 29.6–58.5
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.