Zostera tasmanica

M.Martens ex Asch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Zosteraceae/Zostera

At a glance

Occurrence records281

Data sources12

Biological traits28

DNA specimens4

eDNA detections4

Sources12 archives

Databases and archives Zostera tasmanica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

OBISOcean Biodiversity Information System271 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF · OBIS281 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Zostera tasmanica is a species of marine eelgrass in the Zosteraceae family. It is native to the seacoasts of Tasmania, New South Wales, Victoria, South Australia, and Western Australia.Paul Friedrich August Ascherson. 1876. Sitzungsberichte der Gesellschaft Naturforschender Freunde zu Berlin : 15. Zostera tasmanicaHartog, Cornelis den. 1970. Verhandelingen der Koninklijke Nederlandsche Akademie van Wetenschappen. Afdeeling Natuurkunde, Sectie 2. Amsterdam 59(1): 116. Sea-Grasses of the World Heterozostera tasmanica

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit length3.3 mm

Fruit width1.8 mm

Leaf length220 mm

Leaf width1.1 mm

Plant height0.3 m

Seed length2.88 mm

Seed width1.35 mm

Life cycle & reproduction8

Dispersal typewater

Flowering timeyynnnnnnnyyy

Life formrhizomatous hydrogeophyte

Life spanperennial

Pollination syndromeabiotic

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticaquatic

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Aquatic

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)47.3 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Zostera tasmanica has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ937085.1 ↗227 bpAustralia

ACGT

CATTGTCGATATATGCCTTTGGTTAGACCATGAACAAATTAATTTGCATGAAGCCTTAGCTTTAAGGACCACAATGATGTAAACGTTTTT …

Zostera tasmanica haplotype JHtK71 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Zostera tasmanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 361×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Kuo, J. 2001. Chromosome numbers of the Australian Zosteraceae. Pl. Syst. Evol. 226(3–4): 155–163.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type281 records

Wild obs. + sensor254

Museum / vouchered13

Other14

Range

Area of Occupancy AOO408 km²

Depth

0–200 m sunlit238

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 8 m · 238 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 189≤1 km 64

253 georeferenced · 1 without coordinates

Open the mapobservation + sensor254

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 5≤1 km 1≤10 km 5>10 km 1

12 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
GRAlocation not on record	1

1 institutions · 1 of 13 vouchered records shown · 6 without an institution code

09Environmental DNA4 detections

Where the DNA of Zostera tasmanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)