Zoropsis spinimana

(Dufour, 1820) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Zoropsidae/Zoropsis

At a glance

Occurrence records109 799

Data sources11

Biological traits68

DNA specimens11

eDNA detections7

Sources11 archives

Databases and archives Zoropsis spinimana's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility109 799 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

World Spider Trait DBMasaryk University68 traits · 13 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements13 literature sources68 traits

Occurrence & distributionGBIF109 799 records

Environmental DNA1 datasets · 5 countries7 detections

DNA & barcodingBOLD11 specimens

Genome at a glanceGoaT · NCBI≈2.8 Gbp

01Narrative

Zoropsis spinimana is a spider species belonging to the family Zoropsidae.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 13 sources

Wolff et al. 2022Wolff et al. 2013Wolff et al. 2019Liste France 2018Buchholz et al. 2011Eggs et al. 2015Henrard & Jocqué 2017aMarusik & Kovblyuk 2004Ijland 2010Danışman et al. 2011aNentwig et al. 2018Frost et al. 2018Cardoso et al. 2011

Morphometry46

ALE0.345 mm

AME0.26 mm

Abdomen height6.5 mm

Abdomen length♀8.23·♂4.8 mm

Abdomen width5.46 mm

Body length♀14.62·♂10.3·Both9.4 mm

Cephalothorax height3.49 mm

Cephalothorax length♀6.55·♂5.2 mm

Cephalothorax width♀5.22·♂4.8 mm

Chelicerae basal part (paturon) length2 mm

Claw tuft area♀0.961·Unknown0.17 mm

Claw tuft density♀27 900·Unknown12 700 mm

Cribellum width1.07 mm

Fang length1.6 mm

Femur I length♀5.76·♂5 mm

Femur I width1.34 mm

Femur II length♀5.9·♂5.5 mm

Femur III length♀5·♂4.6 mm

Femur IV length♀6.2·♂5.9 mm

Femur IV width1.45 mm

Leg I length♀21.36·♂21.9 mm

Leg II length♀21.3·♂19.9 mm

Leg III length♀17.9·♂16.8 mm

Leg IV length♀22.8·♂21.9 mm

Metatarsus I length♀5.19·♂6.2 mm

Metatarsus II length♀5.1·♂4.4 mm

Metatarsus III length♀4.7·♂4.4 mm

Metatarsus IV length♀6.62·♂6.5 mm

PLE0.36 mm

PME0.37 mm

Patella I length♀2.71·♂1.9 mm

Patella II length♀3·♂2.2 mm

Patella III length♀2.6·♂1.8 mm

Patella IV length♀2.55·♂1.9 mm

Scopula cover0.425 mm

Spinneret PLS0.57 mm

Tarsus I length♀1.64·♂1.9 mm

Tarsus II length♀1.7·♂1.9 mm

Tarsus III length♀1.6·♂1.8 mm

Tarsus IV length♀1.94·♂2.1 mm

Tibia I length♀6.07·♂6.9 mm

Tibia I width0.82 mm

Tibia II length♀5.6·♂5.9 mm

Tibia III length♀4·♂4.2 mm

Tibia IV length♀5.5·♂5.5 mm

Tibia IV width0.88 mm

Predation8

Hunting guildground hunters

Hunting guild 2ground runner

Prey OrderIsopoda

Prey capturebite-and-release

Prey size♀10.75·♂7.2·Both9.3 mm

Prey stageMusca domestica

Strike speed0.83 mm

Web buildingno

Ecology6

Circadian activitynocturnal

Microhabitatbark, among stones

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (LC)

Regional non-IUCN Red List categoryLeast Concern (*)

Stratumground

Reproduction2

Number of eggs/sac56 mm

Number of eggsacs2 mm

Physiology1

Venom toxicity0.058 mm

Biomechanics1

'Primary mode of locomotionwalking

Life History2

Instar duration26 mm

Number of instars8 mm

Morphology2

Cribellumpresent

Spine number28 mm

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Zoropsis spinimana has left across the world's sequence archives.

At a glance

DNA specimens11

BINs4

Marker genes2

eDNA detections7

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes1

BINs4

Where individuals differ — all 24 variable positions, in barcode order

88Avariable

127Cvariable

217Amostly conserved

256Tmostly conserved

266Cvariable

271Tmostly conserved

286Amostly conserved

307Amostly conserved

343Tvariable

359Avariable

364Tvariable

373Gmostly conserved

502Amostly conserved

511Gvariable

517Tmostly conserved

538Gmostly conserved

544Gmostly conserved

565Tmostly conserved

568Cvariable

571Tmostly conserved

577Amostly conserved

598Cvariable

619Amostly conserved

622Gmostly conserved

AACTTTATATTTAATTTTTGGGGCTTGGGCTTCTATAGTTGGGACTGGAATAAGAGTTTTAATTCGAATAGAGTTAGGACAATCTGGAAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Zoropsis luteasame genus9.3%Micaria nivosasame order12.3%Pisaura acoreensissame order12.6%Pisaura noviciasame order12.8%Cicurina idahoanasame order12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Zoropsis spinimana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈2 848 738 713 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Zoropsis spinimana2.85 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.9% BUSCO

08Occurrence & distribution

Record type109 799 records

Wild obs. + sensor109 578

Museum / vouchered220

Cultivated / captive1

Origin

Introduced680

Range

Area of Occupancy AOO80 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 79 690≤1 km 6 010≤10 km 14 220>10 km 1 304

101 224 georeferenced · 8 354 without coordinates

Open the mapobservation + sensor109 578

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 37≤1 km 5≤10 km 43>10 km 7

92 georeferenced · 128 without coordinates

Open the institutions mapphysical evidence220

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	74
UAclocation not on record	24
Frankfurt am Main	22
Paro, BT	15
	12
Natural History Museum Rotterdamlocation not on record	4
Royal Museum for Central Africalocation not on record	3
Bonn, DE	3
Helsinki, FI	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
Dhaka, BD	2
Copenhagen, DK	2
South Kensington, GB	2
Barcelona, ES	1

14 institutions · 168 of 220 vouchered records shown · 52 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Zoropsis spinimana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map5 countries0

UrbanhouseUrban garden

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 10.3–16.9

Seasonal swing summer↔winter16.3 °C

Max temp (day)16.4 °C 14.1–20.4

Min temp (night)8.40 °C 6.80–12.7

Precipitation71.3 mm/mo 59.1–106

Air humidity62.4 % 57.9–64.6

Moisture balance19.1 mm/mo -28.1–33.3

Vapour deficit593 Pa 445–795

Wind speed2.60 m/s 2.20–4.30

Cloud cover43.0 % 38.8–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Zoropsis spinimana

At a glance

Sources11 archives

Morphometry46

Predation8

Ecology6

Reproduction2

Physiology1

Biomechanics1

Life History2

Morphology2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type109 799 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 14 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type109 799 records