Zodarion rubidum
Simon, 1914 · speciesAt a glance
Occurrence records783
Data sources8
Biological traits60
DNA specimens16
eDNA detections6
Sources8 archives
Databases and archives Zodarion rubidum's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility783 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
World Spider Trait DBMasaryk University60 traits · 33 refs↗
World Spider CatalogNaturhist. Museum Bernworld catalog↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements33 literature sources60 traits
Occurrence & distributionGBIF783 records
Environmental DNA1 datasets · 3 countries6 detections
DNA & barcodingBOLD16 specimens
01Narrative
Zodarion rubidum is a spider species of the family Zodariidae. Like most Zodariidae, Z. rubidum is an ant-eating spider. It resembles ants structurally and behaviorally. Z. rubidum specifically mimics red ants, such as Myrmica sabuleti. It often feeds on Tetramorium caespitum or Lasius platythorax. Zodarion rubidum is up to 5mm in size. Like many other zodariid spiders, it moves across open ground in the evening and at night.
No narrative description available for this taxon yet.
02Traits & measurements
Compiled from 33 sources
Pekár et al. 2018aViel et al. 2025Pekár & Král 2001Pekár 2004Pekár 2014aEntling et al. 2007Buchar & Růžička 2002Liste France 2018Bruun & Lissner 2019Sacher & Platen 2004Hiebsch & Tolke 1996Buchholz et al. 2011Kielhorn 2017Blick & Scheidler 2004Blick et al. 2016Řezáč et al. 2015Maelfait et al. 1998Pekár et al. 2022aVogel 1968Pekár 1994Denis 1935avon Broen & Moritz 1987Bosmans 1994Nentwig et al. 2018Pekár & Král 2002Cárdenas et al. 2014Pekár et al. 2018bPekár 2005Cardoso et al. 2011Couvreur 1989Cushing & Santangelo 2002Gajski et al. 2020Pekár et al. 2012a
Morphometry31
Abdomen length1.05 mm
Abdomen width0.75 mm
Body length♀3.8·♂2.5 mm
Body mass0.001 mm
Cephalothorax length♀1.26·♂1.05 mm
Cephalothorax width♀1.15·♂1.05 mm
Egg size0.79 mm
Femur I length0.96 mm
Femur II length0.85 mm
Femur III length0.8 mm
Femur IV length1.13 mm
Leg I length3.7 mm
Leg II length3.26 mm
Leg III length3.05 mm
Leg IV length5.0 mm
Metatarsus I length0.75 mm
Metatarsus II length0.75 mm
Metatarsus III length0.75 mm
Metatarsus IV length1.13 mm
Patella I length0.35 mm
Patella II length0.3 mm
Patella III length0.3 mm
Patella IV length0.35 mm
Tarsus I length0.55 mm
Tarsus II length0.55 mm
Tarsus III length0.45 mm
Tarsus IV length0.6 mm
Tibia I length0.8 mm
Tibia II length0.65 mm
Tibia III length0.55 mm
Tibia IV length1 mm
Predation7
Consumption time3.42 mm
Hunting guildspecialists
Number of attacks♀2·♂2 mm
Paralysis latency♀352·♂571 mm
Prey OrderHymenoptera: Formicidae
Prey capturebite-and-release
Prey diversity1 mm
Ecology7
Circadian activityBoth14·Unknown14 mm
Light0.875 mm
Light 2open
Moisture 10.5 mm
Moisture 2very dry
Regional IUCN Red List categoryCritically Endangered (CR)
Regional non-IUCN Red List categoryLeast Concern (*)
Reproduction5
Duration of mating1.3 mm
Mating positiontype 3
Number of eggs/sac4.2 mm
Number of eggsacs5 mm
Oviposition9 mm
Physiology2
Temperature preference♀32.95·♂30.65 mm
Venom profiling♀381·Unknown789 mm
Biomechanics2
Distance moved219 mm
Movement492 mm
Life History1
Instar duration♀57.5·Unknown21 mm
Anatomy1
Venom gland size0.014 mm
Cytology2
Chromosome number♀26·♂24 mm
Sex chromosome systemX1X1X2X2
Morphology2
Coloration of prosoma4.83 mm
Colouration of opisthosoma3.88 mm
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Zodarion rubidum has left across the world's sequence archives.
At a glance
DNA specimens16
BINs3
Marker genes2
eDNA detections6
Countries5
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P658 bp consensus13 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.
Where individuals differ — all 113 variable positions, in barcode order
1Gmostly conserved
4Tmostly conserved
22Amostly conserved
31Amostly conserved
34Tmostly conserved
43Tmostly conserved
49Amostly conserved
58Amostly conserved
59Amostly conserved
61Amostly conserved
67Gvariable
68Gmostly conserved
69Gmostly conserved
70Gmostly conserved
83Tmostly conserved
88Gvariable
89Amostly conserved
90Gmostly conserved
91Amostly conserved
95Amostly conserved
97Tmostly conserved
100Tmostly conserved
101Gmostly conserved
109Amostly conserved
112Gmostly conserved
121Tmostly conserved
122Amostly conserved
127Gmostly conserved
130Gmostly conserved
145Amostly conserved
148Gmostly conserved
157Tmostly conserved
169Amostly conserved
173Tmostly conserved
184Amostly conserved
199Amostly conserved
200Gmostly conserved
205Amostly conserved
208Amostly conserved
212Tmostly conserved
217Gmostly conserved
232Amostly conserved
241Tmostly conserved
253Gmostly conserved
256Tmostly conserved
263Cmostly conserved
265Tmostly conserved
277Tmostly conserved
278Tmostly conserved
281Amostly conserved
283Amostly conserved
286Gmostly conserved
301Tmostly conserved
305Gmostly conserved
306Tmostly conserved
307Gvariable
313Gmostly conserved
323Gmostly conserved
325Tmostly conserved
328Amostly conserved
335Amostly conserved
337Tmostly conserved
349Gmostly conserved
355Gvariable
356Tmostly conserved
358Gmostly conserved
359Amostly conserved
360Cmostly conserved
364Amostly conserved
369Tmostly conserved
370Amostly conserved
373Gvariable
376Amostly conserved
379Gmostly conserved
382Tmostly conserved
400Amostly conserved
412Avariable
424Amostly conserved
433Avariable
439Tmostly conserved
449Amostly conserved
451Tmostly conserved
455Amostly conserved
460Avariable
469Avariable
470Cmostly conserved
472Gvariable
473Tmostly conserved
474Gmostly conserved
481Avariable
482Amostly conserved
487Gmostly conserved
490Amostly conserved
494Gmostly conserved
502Gmostly conserved
514Tmostly conserved
518Tmostly conserved
526Amostly conserved
532Tvariable
539Cmostly conserved
541Tmostly conserved
547Amostly conserved
550Gvariable
556Amostly conserved
562Amostly conserved
583Amostly conserved
592Amostly conserved
622Amostly conserved
628Amostly conserved
638Gmostly conserved
640Amostly conserved
643Gmostly conserved
655Amostly conserved
GACTTTATATTTAATTTTTGGAGCTTGGTCAGCTATAGTAGGTACAGCAATAAGAGTAATAATTCGGGGGGAATTAGGTCAATCTGGGAG …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)4.2%
Haplotypes5
BINs3
Most divergent pair16.1%
EuropeN.America
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P18S-5P
animal barcoderibosomal
08Occurrence & distribution
Record type783 records
Wild obs. + sensor456
Museum / vouchered327
Origin
Introduced91
Range
Area of Occupancy AOO1 180 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy48% within 1 km
≤100 m 145≤1 km 39≤10 km 187>10 km 10
381 georeferenced · 75 without coordinates
Open the mapobservation + sensor456
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 7≤1 km 18≤10 km 43
68 georeferenced · 259 without coordinates
Open the institutions mapphysical evidence327
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions7 of 18 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Adam Mickiewicz University in Poznańlocation not on record | 116 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 44 |
| Denver, US | 35 |
| Ohio State University Acarology Laboratorylocation not on record | 19 |
| Paro, BT | 18 |
| Brussels, BE | 13 |
| Bonn, DE | 10 |
| Provincia di Livornolocation not on record | 9 |
| Chicago, US | 9 |
| SNSDlocation not on record | 5 |
| University of Lodz, Department of Invertebrate Zoology and Hydrobiologylocation not on record | 2 |
| ZSMlocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| University of Guelph, Centre for Biodiversity Genomicslocation not on record | 1 |
| San Francisco, US | 1 |
| Royal Ontario Museumlocation not on record | 1 |
| SNSB-Zoologische Staatssammlung Münchenlocation not on record | 1 |
| Frankfurt am Main | 1 |
18 institutions · 287 of 327 vouchered records shown · 39 without an institution code
09Environmental DNA6 detections
Where the DNA of Zodarion rubidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.70 °C 5.00–17.3
Seasonal swing summer↔winter18.8 °C
Max temp (day)13.5 °C 8.20–21.4
Min temp (night)5.40 °C 1.90–12.9
Precipitation61.0 mm/mo 49.2–73.9
Air humidity60.6 % 57.8–66.0
Moisture balance-24.5 mm/mo -52.1–28.4
Vapour deficit555 Pa 324–880
Wind speed3.30 m/s 2.60–4.90
Cloud cover42.0 % 35.9–47.6
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.