Zigadenus glaberrimus

Michx. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Melanthiaceae/Zigadenus

At a glance

Occurrence records638

Data sources9

Biological traits12

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Zigadenus glaberrimus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF638 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT5.2 Gbp

01Narrative

Zigadenus glaberrimus Michx. – gatunek roślin z monotypowego rodzaju Zigadenus z rodziny melantkowatych, występujący w południowo-wschodnich Stanach Zjednoczonych.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass0.736 mg

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Zigadenus glaberrimus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences8

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF303713.1 ↗808 bp

ACGT

CGCGGTGACGCAGGCGGTCCGCCGCCCGCGATGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTT …

Zigadenus glaberrimus 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Zigadenus glaberrimus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 202 960 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Zigadenus glaberrimus5.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidy6× hexaploid · measured

Chromosome records52–542n range53median54mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 521×CCDB · eflora

CCDB · eflora

2n 541×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type638 records

Wild obs. + sensor377

Museum / vouchered260

Cultivated / captive1

Range

Area of Occupancy AOO1 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 118≤1 km 26≤10 km 18>10 km 152

314 georeferenced · 63 without coordinates

Open the mapobservation + sensor377

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 27≤1 km 24≤10 km 77>10 km 42

170 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence260

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapel Hill, US	63
Bangkok, TH	33
Jackson, US	28
Tuscaloosa, US	15
Tampa, US	13
Columbia, US	10
University of Southern Mississippilocation not on record	9
Miami, US	8
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	7
University of Stellenboschlocation not on record	7
Chongqing Museumlocation not on record	7
AUAlocation not on record	6
Jena Microbial Resource Collectionlocation not on record	5
Bloomington, US	5
San Angelo, US	5
Bronx, US	4
Tall Timbers Research Stationlocation not on record	3
US	3
University of North Carolina at Pembrokelocation not on record	2
Weymouth Woods Sandhills Nature Preservelocation not on record	2
Norfolk, US	2
Valdosta State Universitylocation not on record	2
WTUlocation not on record	2
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	2
Wuzhou, CN	1
Little Rock, US	1
Long Beach, US	1
Philadelphia, US	1
Williamsburg, US	1
Auckland, NZ	1
GAlocation not on record	1
Dekalb, US	1
College Park, US	1
Logan, US	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Burlington, US	1
BAYLUlocation not on record	1
Oskarshamn, SE	1
New Haven, US	1
Taipei, TW	1

40 institutions · 259 of 260 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Zigadenus glaberrimus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)