Zelleromyces cinnabarinus

Singer & A.H.Sm. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Russulales/Russulaceae/Zelleromyces

At a glance

Occurrence records39

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Zelleromyces cinnabarinus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility39 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF39 records

DNA & barcodingNCBIsequences

01Narrative

Zelleromyces cinnabarinus is a North American gasteroid fungus species in the family Russulaceae with a cinnabar-red peridium. It is the type species of Zelleromyces, and like other members of its genus, it should probably be transferred to the genus Lactarius which it belongs to phylogenetically. It was described from a collection made under pine near Baton Rouge, Louisiana.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Zelleromyces cinnabarinus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP337364.1 ↗500 bpUSA · 2023

ACGT

CCCCCCCCCCTTTCAAAAAGTGTAGAATGACCTCATATGTGCGCTAACCCGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTC …

Zelleromyces cinnabarinus voucher FLAS:F-72148 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type39 records

Wild obs. + sensor9

Museum / vouchered30

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 4>10 km 3

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 2≤1 km 4≤10 km 18>10 km 1

25 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chapel Hill, US	10
ILLSlocation not on record	4
Durham, US	3
Chicago, US	3
Blacksburg, US	3
Baton Rouge, US	2
Adam Mickiewicz University in Poznańlocation not on record	2
Champaign, US	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1

9 institutions · 29 of 30 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)