Zasmidium cellare

(Pers.) Fr. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Zasmidium

At a glance

Occurrence records33

Data sources10

Biological traits0

DNA specimens5

eDNA detections6

Sources10 archives

Databases and archives Zasmidium cellare's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF33 records

Environmental DNA4 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT · NCBI38 Mbp

01Narrative

Zasmidium cellare, also known as cellar mold, is a species of fungus that exists in dark, ethanol-rich environments and is brown to black in colour. This species primarily exists in wine and brandy cellars in central and southern Europe, but can be found in surrounding regions and is thought to be helpful in the wine making process by some and a hygienic issue by others. Not much is known about Z. cellare's sexual biology and is thought to be beneficial to the cleanliness of cellar air due to its ability to consume musty odours.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Zasmidium cellare has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences7

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKT316739.1 ↗484 bpHungary

ACGT

ACCCTTTTTGTGAACCACCTCGTTGCCTCGGGGGCGACCCTGCCGTGCTCTCGGGTGCGGTGGGGGCTCCCGGCGGCCCCTTCAAACCCT …

Zasmidium cellare isolate 776 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS7

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Zasmidium cellare carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size38 250 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Zasmidium cellare0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type33 records

Wild obs. + sensor3

Museum / vouchered28

Other2

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 12>10 km 1

13 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Karlsruhe, DE	7
Museo Entomologico de Leonlocation not on record	4
DPIlocation not on record	2
Champaign, US	2
Catholic University of Pekinglocation not on record	2
PHlocation not on record	2
Lincoln, US	1
LDlocation not on record	1
Uppsala, SE	1
Madison, US	1

10 institutions · 23 of 28 vouchered records shown · 3 without an institution code

09Environmental DNA6 detections

Where the DNA of Zasmidium cellare was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys4

Countries1

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 8.30–8.30

Seasonal swing summer↔winter17.7 °C

Max temp (day)11.9 °C

Min temp (night)4.60 °C

Precipitation58.1 mm/mo

Air humidity64.0 %

Moisture balance-4.10 mm/mo

Vapour deficit449 Pa

Wind speed3.70 m/s

Cloud cover41.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)