Zantedeschia aethiopica
(L.) Spreng. · speciesAt a glance
Occurrence records30 313
Data sources15
Biological traits49
DNA specimens21
eDNA detections13
Sources15 archives
Databases and archives Zantedeschia aethiopica's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility30 285 records↗
OBISOcean Biodiversity Information System28 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources49 traits
Chemical compositionLOTUS · NPASS40 compounds
Occurrence & distributionGBIF · OBIS30 313 records
Environmental DNA1 datasets · 4 countries13 detections
DNA & barcodingBOLD21 specimens
Genome at a glanceCCDB · GIFT2n = 32
01Narrative
Zantedeschia aethiopica, commonly known as calla lily and arum lily, is a species of flowering plant in the family Araceae, native to southern Africa in Lesotho, South Africa, and Eswatini.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology16
Fruit length7.5 mm
⚠ sources differ — AusTraits: 7.5 mm · GIFT: 10 mm
Fruit width10 mm
Inflorescence length max9 cm
Leaf length500 mm
Leaf length max1 000 mm
Leaf length min150 mm
Leaf width30 mm
⚠ sources differ — AusTraits: 30 mm · GIFT: 165 mm
Leaf width max600 mm
Leaf width min60 mm
Petiole length60.05 cm
Plant height1 m
⚠ sources differ — GIFT: 1 m · AusTraits: 1 m · TRY: 0.4 m
Plant height max1.5 m
Plant height min0.34 m
Seed mass20.26 mg
Seed mass max20.26 mg
Seed mass min20.26 mg
Life cycle & reproduction16
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeunspecialized
Flower colouryellow
Flowering endJun
Flowering startNov
Flowering timennnnnnnnyyyn
Life formtuberous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualpresent
Resprouting capacityresprouts
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 250 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourorange
Fruit typeberry
Growth formherb
Habitat GIFTLowland
Leaf shapecordate ovate
Mycorrhiza typePh.th.end.
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits1
Seeds per fruit101-1000
03Chemical composition40 compounds
Compounds documented for Zantedeschia aethiopica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Stigmastane steroids9
Neolignans7
Ergostane steroids $ Stigmastane steroids6
Cinnamic acids and derivatives6
Flavones5
Documented compounds40 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Pinoresinol | present | LOTUS | |
| (1R,2R)-1-[4-[(1R,2R)-1,3-dihydroxy-1-(4-hydroxy-3-methoxyphenyl)propan-2-yl]oxy-3-methoxyphenyl]propane-1,2,3-triol | present | LOTUS | |
| (1R,2R)-2-[4-[(2R)-2,3-dihydroxypropyl]-2-methoxyphenoxy]-1-(4-hydroxy-3-methoxyphenyl)propane-1,3-diol | present | LOTUS | |
| (1S)-1,5-Anhydro-1-[2-(3,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-4-oxo-4H-1-benzopyran-8-yl]-D-glucitol | present | LOTUS | |
| (1S,2S)-1-[4-[(1R,2R)-1,3-dihydroxy-1-(4-hydroxy-3-methoxyphenyl)propan-2-yl]oxy-3-methoxyphenyl]propane-1,2,3-triol | present | LOTUS | |
| (1S,2S)-2-[4-[(2S)-2,3-dihydroxypropyl]-2-methoxyphenoxy]-1-(4-hydroxy-3-methoxyphenyl)propane-1,3-diol | present | LOTUS | |
| (3S,4S,5R,9R,10S,13R,14R,17R)-4,10,13-trimethyl-17-[(2R)-6-methyl-5-methylideneheptan-2-yl]-2,3,4,5,6,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS | |
| (3S,5R,9R,10S,13R,14R,17R)-10,13-dimethyl-17-[(2R)-6-methyl-5-methylideneheptan-2-yl]-2,3,4,5,6,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS | |
| (E)-Isosyringin | present | LOTUS | |
| 1,2,3-Propanetriol, 1-(4-hydroxy-3-methoxyphenyl)-, (1R,2R)- | present | LOTUS |
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Zantedeschia aethiopica has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes4
eDNA detections13
Countries4
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P1 584 bp consensus3 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.
Diversity (π)0.34%
Haplotypes1
BINs0
Where individuals differ — all 8 variable positions, in barcode order
692Cvariable
693Cvariable
696Avariable
697Tvariable
763Gvariable
928Gvariable
1377Cvariable
1451Avariable
ATGACAAATCCGGTCCGATGGCTGTTCTCTACTAACCACAAGGATATAGGTACTCTATATTTCATCTTCGGTGCCATTGCTGGAGTGATG …
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL★rbcLa
animal barcodeplant barcode
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_073008 ↗ · 34 protein · 22 tRNA · 3 rRNA
nad1nad2rps7nad5ccmFNrpl10ccmCcox2nad6ccmBmatRrps4mttBcox1nad7sdh4cox3atp8ccmFCcobrps14rpl5atp4nad4Lrps3rpl16+11
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GIFT
The complete instruction manual Zantedeschia aethiopica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidydiploid inferred
Chromosome records24–322n range32median32mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3215×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · araceae +4
CCDB · ipcn-api-dl — Yao, J. l., R. E. Rowland & D. Cohen. 1994. Karyotype studies in the genus Zantedeschia (Araceae). S. African J. Bot. 60: 4–7.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · book-indian_vol2 — Overton, J.B. 1909 ; Ito, T. 1942 ; Earl, G. 1957 ; Jones, G.E. 1957 ; Pfitzer, P. 1957a
CCDB · book-indian_vol2 — Overton, J.B. 1909
CCDB · araceae — Yao et al., 1994
CCDB · araceae — Petersen, 1989
CCDB · book-fedorov — Overton J. B. 1909
CCDB · book-fedorov — Overton J. 1009
CCDB · book-fedorov — Ito 1942
CCDB · book-fedorov — Earl il!lli7
CCDB · book-fedorov — Jones G. E. 1957
CCDB · book-fedorov — P~itzell' i957a -
CCDB · book-atlas-flowering-plants
CCDB · Cave1957 — Earl
GIFT · GIFT (floras)
2n 246×CCDB · book-indian_vol2 · CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Michell (Ito, T. 1942) ; Earl, G. 1955
CCDB · book-indian_vol2 — Michel, M.R. 1916
CCDB · book-fedorov — Michel 1916
CCDB · book-fedorov — Michell (Ito 1942)
CCDB · book-fedorov — Earl 1955 (I. 1956)
GIFT · GIFT (floras)
2n 284×CCDB · book-indian_vol2 · CCDB · book-fedorov · CCDB · Cave1956supp +1
CCDB · book-indian_vol2 — Mookerjea, A. 1955a
CCDB · book-fedorov — Mookerjea 1955a
CCDB · Cave1956supp — Mookerjea 1955b
GIFT · GIFT (floras)
n 162×CCDB · araceae
CCDB · araceae — Yao et al., 1994
CCDB · araceae — Petersen, 1989
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type30 313 records
Wild obs. + sensor28 973
Museum / vouchered1 128
Cultivated / captive132
Other80
Origin
Native42
Introduced2 001
Range
Area of Occupancy AOO52 988 km²
Depth
0–200 m sunlit18
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 1.5 m · max 115 m · 18 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 16 854≤1 km 3 616≤10 km 1 680>10 km 447
22 597 georeferenced · 6 376 without coordinates
Open the mapobservation + sensor28 973
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy69% within 1 km
≤100 m 126≤1 km 150≤10 km 113>10 km 12
401 georeferenced · 727 without coordinates
Open the institutions mapphysical evidence1 128
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy67% within 1 km
≤1 km 2≤10 km 1
3 georeferenced · 129 without coordinates
Open the mapnot free-living132
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions110 of 177 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Pretoria, ZA | 98 |
| Adelaide, AU | 64 |
| Auckland, NZ | 63 |
| Christchurch, NZ | 55 |
| Durban, ZA | 50 |
| Kensington, AU | 46 |
| Saint Louis, US | 33 |
| Durango, MX | 32 |
| Museo Entomologico de Leonlocation not on record | 26 |
| Canberra, AU | 26 |
| National Biodiversity Institute, Costa Ricalocation not on record | 22 |
| Hobart, AU | 19 |
| Universidad de Caldas (UCaldas)location not on record | 14 |
| BIO-UNIPIlocation not on record | 13 |
| Mexico City, MX | 13 |
| MAlocation not on record | 12 |
| Mount Annan, AU | 12 |
| Bronx, US | 11 |
| Santa Barbara, US | 10 |
| Riverside, US | 7 |
| Corvallis, US | 7 |
| Rotorua, NZ | 7 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 7 |
| Madison, US | 7 |
| San Luis Obispo, US | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Ann Arbor, US | 6 |
| Kew, GB | 6 |
| Claremont, US | 6 |
| Blumenau, BR | 5 |
| Austin, US | 5 |
| San Francisco, US | 5 |
| Bloomington, US | 5 |
| Mexico City, MX | 5 |
| Cape Town, ZA | 5 |
| Turlock, US | 5 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 5 |
| Chongqing Museumlocation not on record | 4 |
| San Diego, US | 4 |
| CASlocation not on record | 4 |
| Chicago, US | 4 |
| Northridge, US | 4 |
| GHPG$location not on record | 4 |
| San José, CR | 4 |
| Henry Brockhouse Collectionlocation not on record | 4 |
| València, ES | 4 |
| Puebla, MX | 4 |
| Irvine, US | 3 |
| Wellington, NZ | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| Badajoz, ES | 3 |
| Flagstaff, US | 3 |
| GB | 3 |
| Universidad de Antioquia (UdeA)location not on record | 3 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Civico Museo di Scienze naturali Giuseppe Orlandilocation not on record | 3 |
| Bern, CH | 3 |
| University of New Hampshirelocation not on record | 3 |
| Ciudad de México, MX | 3 |
| Yangling, CN | 3 |
| Wollongong, AU | 3 |
| Beijing, CN | 3 |
| Santa Cruz, US | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| University of Johannesburglocation not on record | 3 |
| Davis, US | 3 |
| BDBClocation not on record | 3 |
| Xiamen, CN | 3 |
| Barcelona, ES | 3 |
| Autlán de Navarro, MX | 3 |
| BClocation not on record | 3 |
| Arcata, US | 3 |
| University of Stellenboschlocation not on record | 3 |
| Batemans Bay, AU | 3 |
| Wlocation not on record | 3 |
| Brisbane, AU | 2 |
| Ischia Marine Centrelocation not on record | 2 |
| Philadelphia, US | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| MSB-3049location not on record | 2 |
| Tsukuba, JP | 2 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 2 |
| Angwin, US | 2 |
| Vitoria, ES | 2 |
| Provincia di Livornolocation not on record | 2 |
| Berlin, DE | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Tampa, US | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Salvador, BR | 2 |
| Aarhus, DK | 2 |
| Long Beach, US | 2 |
| UTPLlocation not on record | 2 |
| TAFORI-LSRClocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Austin, US | 2 |
| Taipei, TW | 2 |
| Puerto Ayora, EC | 2 |
| Uppsala, SE | 2 |
| Altos de Pipe, VE | 2 |
| arosemena tola, EC | 2 |
| Chapingo, MX | 2 |
| Palmerston North, NZ | 2 |
| PRClocation not on record | 1 |
| Taipei, TW | 1 |
| Jaén, ES | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Arusha, TZ | 1 |
| La Paz, BO | 1 |
| Riobamba, EC | 1 |
| Kunming, CN | 1 |
| IEBlocation not on record | 1 |
| BISHlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| ESALQlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Podgorica, ME | 1 |
| UFBAlocation not on record | 1 |
| Juriquilla, MX | 1 |
| EL PASO, US | 1 |
| Ciudad de México, MX | 1 |
| León, NI | 1 |
| Viña del Mar, CL | 1 |
| Vancouver, CA | 1 |
| Smithsonian Institution, National Museum of Natural Historylocation not on record | 1 |
| Alexandria Universitylocation not on record | 1 |
| Madrid, ES | 1 |
| Tartu, EE | 1 |
| Granada, ES | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Armidale, AU | 1 |
| Alicante, ES | 1 |
| Provo, US | 1 |
| CHAPAlocation not on record | 1 |
| San Sebastián, ES | 1 |
| Cambridge, US | 1 |
| Tapachula, MX | 1 |
| Phoenix, US | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| US | 1 |
| CJBGlocation not on record | 1 |
| Pondicherry, IN | 1 |
| Tlalnepantla, MX | 1 |
| San Francisco, US | 1 |
| Mexico City, MX | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Córdoba, AR | 1 |
| Salta, AR | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| INMAlocation not on record | 1 |
| Chiba, JP | 1 |
| Weber State Universitylocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Bangkok, TH | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Loja, EC | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| UFSCarlocation not on record | 1 |
| Denver, US | 1 |
| UNESP-RClocation not on record | 1 |
| Fort Worth, US | 1 |
| Ivano-Frankivsk, UA | 1 |
| QAPlocation not on record | 1 |
| WTUlocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| Morelia, MX | 1 |
| LDlocation not on record | 1 |
177 institutions · 985 of 1 128 vouchered records shown · 113 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Zantedeschia aethiopica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map4 countries0
Coastal sage scrub, Artemisia californica on…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 12.3–17.1
Seasonal swing summer↔winter10.4 °C
Max temp (day)19.9 °C 16.6–21.4
Min temp (night)10.4 °C 7.80–14.8
Precipitation70.4 mm/mo 6.60–91.7
Air humidity59.8 % 56.5–62.4
Moisture balance-28.0 mm/mo
Vapour deficit773 Pa 567–823
Wind speed2.90 m/s
Cloud cover28.5 % 10.8–41.2
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.