Xylosandrus germanus

C.H.Hoffmann, 1941 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Curculionidae/Xylosandrus

At a glance

Occurrence records2 443

Data sources6

Biological traits0

DNA specimens526

eDNA detections449

Sources6 archives

Databases and archives Xylosandrus germanus's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 443 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI449 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics526 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 443 records

Environmental DNA2 datasets · 10 countries449 detections

DNA & barcodingBOLD526 specimens

Genome at a glanceGoaT · TreeOfSex2n = 16

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding526 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xylosandrus germanus has left across the world's sequence archives.

At a glance

DNA specimens526

BINs4

Marker genes3

eDNA detections449

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus443 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

261Avariable

279Cmostly conserved

339Tmostly conserved

468Tmostly conserved

CTATATTTCATTTTTGGTGCATGGGCAGGAATAGTAGGAACATCATTAAGAGTAATTATCCGAACAGAGCTCGGAACACCAGGAAGATTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.89%

Haplotypes14

BINs4

Most divergent pair2.5%

AsiaEuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Xylosandrus eupatoriisame genus10.5%Euwallacea andamanensissame family12.9%Xylosandrus compactussame genus13.8%Xylosandrus derupteterminatussame genus13.9%Diuncus mucronatussame family14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★COI-PSEUDO

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_036280 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Xylosandrus germanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records8–162n range16median16mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 164×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

2n 83×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type2 443 records

Wild obs. + sensor59

Museum / vouchered2 384

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 18≤1 km 7≤10 km 4>10 km 5

34 georeferenced · 25 without coordinates

Open the mapobservation + sensor59

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 3≤1 km 1≤10 km 1

5 georeferenced · 2 379 without coordinates

Open the institutions mapphysical evidence2 384

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	69
OSUClocation not on record	10
Wuzhou, CN	3
Naturalis Biodiversity Centerlocation not on record	3
Sagamihara, JP	2
Bavarian State Collection of Zoologylocation not on record	1
IRSTEAlocation not on record	1

7 institutions · 89 of 2 384 vouchered records shown · 2 264 without an institution code

09Environmental DNA449 detections

Where the DNA of Xylosandrus germanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found449

Studies independent surveys2

Countries10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 449 detections have coordinates

Open the map10 countries0

14. Artificial - Terrestrial|14.5 Urban AreasForest1.4. Temperate Forest|1. Forest & Woodland1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodlanddeadwood

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.7 °C 9.70–20.2

Seasonal swing summer↔winter18.7 °C

Max temp (day)21.9 °C 13.4–22.6

Min temp (night)13.6 °C 4.10–16.6

Precipitation160 mm/mo 84.7–227

Air humidity64.2 % 57.7–74.0

Moisture balance47.3 mm/mo -57.7–109

Vapour deficit617 Pa 469–865

Wind speed1.70 m/s 1.60–3.10

Cloud cover36.6 % 21.1–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 427 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xylosandrus germanus

At a glance

Sources6 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 443 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 7 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 443 records