Xerochlamys undulata — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malvales/Sarcolaenaceae/Xerochlamys

At a glance

Occurrence records145

Data sources5

Biological traits11

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Xerochlamys undulata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility145 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF145 records

DNA & barcodingNCBIsequences

01Narrative

Xerochlamys undulata is a shrub in the family Sarcolaenaceae. It is endemic to Madagascar.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xerochlamys undulata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLKX588788.1 ↗1 401 bp

ACGT

CTAAAGCAAGTGTTGGATTCAAAGCAGGTGTTAAAGAGTATAAATTGACTTATTATACTCCTCAATACCAAACCAAAGATACTGATATCT …

Xerochlamys undulata voucher Randrianasolo 241 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type145 records

Wild obs. + sensor14

Museum / vouchered131

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 14

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	39
Plocation not on record	28
Saint Louis, US	17
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	12
Kew, GB	9
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	8
MeiseBGlocation not on record	4
Stockholm, SE	3
Bronx, US	2
CJBGlocation not on record	1
University of Stellenboschlocation not on record	1
WAGlocation not on record	1
Frankfurt am Main	1

13 institutions · 126 of 131 vouchered records shown · 5 without an institution code