Xerochlamys itremoensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malvales/Sarcolaenaceae/Xerochlamys

At a glance

Occurrence records68

Data sources5

Biological traits11

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Xerochlamys itremoensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility68 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF68 records

DNA & barcodingNCBIsequences

01Narrative

Xerochlamys itremoensis is a shrub in the family Sarcolaenaceae. It is endemic to Madagascar.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xerochlamys itremoensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKX588816.1 ↗680 bp

ACGT

GATGCCTGCCTGGCAGAACGACCCGCGAATCAGTTAACAACGCGGGGGGGCGTCGGGCAATCGCCGGGGTCCCCCCCAACAGGCCGCGGA …

Xerochlamys itremoensis voucher Schatz 3959 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor18

Museum / vouchered50

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 18

18 georeferenced

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	19
Plocation not on record	9
Saint Louis, US	6
Kew, GB	6
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	4
Glocation not on record	1
CJBGlocation not on record	1

7 institutions · 46 of 50 vouchered records shown · 4 without an institution code