Xenolechia ontariensis

Keifer, 1933 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Xenolechia

At a glance

Occurrence records222

Data sources7

Biological traits0

DNA specimens108

eDNA detections115

Sources7 archives

Databases and archives Xenolechia ontariensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility222 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI115 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics108 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF222 records

Environmental DNA1 datasets · 2 countries115 detections

DNA & barcodingBOLD108 specimens

01Narrative

Xenolechia ontariensis is a moth of the family Gelechiidae. It is found in North America, where it has been recorded from Manitoba to Texas, as well as Arizona and possibly California.Xenolechia at funetmothphotographersgroup The wingspan is about 12 mm. Adults are similar to Xenolechia querciphaga, but the ground colour is whitish-grey and the overlying wing colour is distinctly browner.Calif. Dept. Agric., Mon. Bull. 22 : 358 Adults are on wing from April to July.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding108 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xenolechia ontariensis has left across the world's sequence archives.

At a glance

DNA specimens108

BINs5

Marker genes1

eDNA detections115

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus104 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

10Tmostly conserved

59Tmostly conserved

82Tmostly conserved

91Cmostly conserved

112Cmostly conserved

142Cmostly conserved

217Amostly conserved

223Tmostly conserved

235Tmostly conserved

283Tmostly conserved

313Tmostly conserved

340Tmostly conserved

343Amostly conserved

358Tmostly conserved

367Tmostly conserved

370Amostly conserved

382Tvariable

400Tmostly conserved

479Tmostly conserved

517Amostly conserved

541Tmostly conserved

556Amostly conserved

562Amostly conserved

581Tmostly conserved

613Tmostly conserved

634Cmostly conserved

646Tmostly conserved

TACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.87%

Haplotypes22

BINs5

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Xenolechia querciphagasame genus1.5%Carpatolechia notatellasame family3.5%Carpatolechia fugitivellasame family3.8%Carpatolechia alburnellasame family4.0%Carpatolechia belangerellasame family4.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type222 records

Wild obs. + sensor127

Museum / vouchered95

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 74≤1 km 23≤10 km 6>10 km 10

113 georeferenced · 14 without coordinates

Open the mapobservation + sensor127

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 3≤10 km 5>10 km 1

10 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	59
Washington, US	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Cornell University Insect Collectionlocation not on record	3
San Francisco, US	1
Biodiversity Institute of Ontariolocation not on record	1
SLRClocation not on record	1
Research Collection of Daniel Handfieldlocation not on record	1
East Lansing, US	1

9 institutions · 78 of 95 vouchered records shown · 17 without an institution code

09Environmental DNA115 detections

Where the DNA of Xenolechia ontariensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found115

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 115 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandForestshortgrass prairie in riverine willows14. Artificial - Terrestrial|14.5 Urban Areashighbush blueberry cropsGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 15.2–20.9

Seasonal swing summer↔winter27.2 °C

Max temp (day)23.7 °C 21.4–25.9

Min temp (night)14.1 °C 10.0–17.1

Precipitation90.3 mm/mo 75.5–133

Air humidity57.5 % 54.6–59.7

Moisture balance-49.6 mm/mo -84.3–-21.2

Vapour deficit921 Pa 794–1,120

Wind speed3.30 m/s 2.70–5.60

Cloud cover40.7 % 37.3–47.1

CHELSA 1981–2010, ~9 km grid, at location & month of 113 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)