Xanthostemon youngii

C.T.White & Francis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Xanthostemon

At a glance

Occurrence records94

Data sources6

Biological traits21

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Xanthostemon youngii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility94 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF94 records

DNA & barcodingNCBIsequences

01Narrative

Xanthostemon youngii, commonly known as crimson penda or red penda, is a species of trees endemic to North Queensland, constituting part of the plant family Myrtaceae. It has showy red blooms, but has been difficult to keep alive in cultivation. It is extremely prone to Myrtle Rust disease that has spread rapidly throughout the east coast of Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology7

Fruit length13.5 mm

Fruit width13.5 mm

Leaf length55 mm

Leaf width23.5 mm

Plant height17 m

Seed length5 mm

Seed width3.5 mm

Life cycle & reproduction5

Flowering timennnnnyyyynnn

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: tree

Leaf compoundnesssimple

Woodinesswoody

03Chemical composition5 compounds

Compounds documented for Xanthostemon youngii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Farnesane sesquiterpenoids2

Isodaucane sesquiterpenoids1

Cadinane sesquiterpenoids1

Menthane monoterpenoids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Mintsulfide	present	LOTUS
1,3-Dimethoxy-5-(propan-2-yl)benzene	present	LOTUS
Calamenene, cis-(+)-	present	LOTUS
Farnesoic acid	present	LOTUS
Methyl farnesoate	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthostemon youngii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKPP623867.1 ↗713 bp

ACGT

GGGTGAAAGATGCCTCTTCTTTGCATTTATTACGTTTCTTTCTCCACGAGTATTGGAATAATCTTATTACTCCAAAGAAAGATATTACCC …

Xanthostemon youngii maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type94 records

Wild obs. + sensor4

Museum / vouchered90

Origin

Native6

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 12≤1 km 13≤10 km 22>10 km 3

50 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	41
Brisbane, AU	25
Mount Annan, AU	6
Kew, GB	3
Canberra, AU	3
Museo Entomologico de Leonlocation not on record	2
Palmerston, AU	2
Honolulu, US	1

8 institutions · 83 of 90 vouchered records shown · 7 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)