Xanthostemon whitei

Gugerli · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Xanthostemon

At a glance

Occurrence records168

Data sources7

Biological traits29

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Xanthostemon whitei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility168 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF168 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Xanthostemon whitei là một loài thực vật có hoa trong Họ Đào kim nương. Loài này được Gugerli miêu tả khoa học đầu tiên năm 1934.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology12

Fruit length12.5 mm

Fruit width12.5 mm

Leaf length170 mm

Leaf mass per area109 g/m2

Leaf size9 140 mm²

Leaf width52.5 mm

Plant height15 m

⚠ sources differ — GIFT: 15 m · AusTraits: 40 m

Seed length4 mm

Seed mass3.2 mg

Seed mass max3.2 mg

Seed mass min3.2 mg

Seed width2.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timeynnnnnnyyyyy

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density908 mg/cm³

03Chemical composition5 compounds

Compounds documented for Xanthostemon whitei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Farnesane sesquiterpenoids2

Cadinane sesquiterpenoids1

Isodaucane sesquiterpenoids1

Menthane monoterpenoids1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Mintsulfide	present	LOTUS
1,3-Dimethoxy-5-(propan-2-yl)benzene	present	LOTUS
Calamenene, cis-(+)-	present	LOTUS
Farnesoic acid	present	LOTUS
Methyl farnesoate	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthostemon whitei has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496720.1 ↗566 bpAustralia · 2013

ACGT

CTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAACTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCT …

Xanthostemon whitei isolate B59 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type168 records

Wild obs. + sensor31

Museum / vouchered134

Cultivated / captive1

Other2

Origin

Native14

Range

Area of Occupancy AOO292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 7≤1 km 2≤10 km 6

15 georeferenced · 16 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 17≤1 km 7≤10 km 45>10 km 6

75 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence134

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	57
Brisbane, AU	32
Mount Annan, AU	13
Canberra, AU	10
Museo Entomologico de Leonlocation not on record	5
Parkville, AU	2
James Cook Townsvillelocation not on record	2
Kew, GB	2
Palmerston, AU	2

9 institutions · 125 of 134 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Xanthostemon whitei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)