Xanthostemon oppositifolius

F.M.Bailey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Xanthostemon

At a glance

Occurrence records190

Data sources11

Biological traits27

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Xanthostemon oppositifolius's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility190 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Chemical compositionLOTUS · NPASS111 compounds

Occurrence & distributionGBIF190 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Xanthostemon oppositifolius is a species of plant in the family Myrtaceae. It is found in Australia and Papua New Guinea. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length10 mm

Leaf length85 mm

Leaf mass per area142 g/m2

Leaf size2 679 mm²

Leaf width32.5 mm

Plant height25 m

Seed length2.5 mm

Seed mass5.72 mg

⚠ sources differ — TRY: 5.72 mg · AusTraits: 3.76 mg

Seed width1.5 mm

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)7.03 mm²/mg

Wood density964 mg/cm³

03Chemical composition111 compounds

Compounds documented for Xanthostemon oppositifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Neolignans27

Furanoid lignans21

Dibenzylbutane lignans11

Cinnamic acids and derivatives9

Minor lignans $ Neolignans3

Documented compounds111 total

Tissue Source Quantified only

Compound	Amount	Source
((7S)-8'-(benzo[3',4']dioxol-1'-yl)-7-hydroxypropyl)benzene-2,4-diol	present	NPASS
(+)-Fragransin A2	present	NPASS
(+)-Sabinene	present	NPASS
(+)-Saucernetindiol	present	NPASS
(-)-Acuminatin	present	NPASS
(-)-Licarin A	present	NPASS
(-)-Licarin B	present	NPASS
(-)-Licarin-B	present	NPASS
(-)-Mintsulfide	present	LOTUS
(1R,2R)-2-(2,6-dimethoxy-4-prop-2-enylphenoxy)-1-(3,4,5-trimethoxyphenyl)propane-1,3-diol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthostemon oppositifolius has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896125.1 ↗553 bpAustralia

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAACTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …

Xanthostemon oppositifolius voucher 129308714 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type190 records

Wild obs. + sensor25

Museum / vouchered82

Cultivated / captive4

Other79

Origin

Native10

Introduced1

Range

Area of Occupancy AOO252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 14≤1 km 3>10 km 2

19 georeferenced · 6 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 38≤1 km 7≤10 km 19>10 km 8

72 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence82

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	61
Mount Annan, AU	5
Museo Entomologico de Leonlocation not on record	5
Smithfield, AU	4
Canberra, AU	4
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

6 institutions · 80 of 82 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Xanthostemon oppositifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.8 °C 20.8–20.8

Seasonal swing summer↔winter10.4 °C

Max temp (day)25.9 °C

Min temp (night)16.4 °C

Precipitation90.9 mm/mo

Air humidity57.4 %

Moisture balance-19.5 mm/mo

Vapour deficit1,056 Pa

Wind speed1.90 m/s

Cloud cover26.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)