Xanthorrhoea thorntonii

Tate · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records215

Data sources6

Biological traits30

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Xanthorrhoea thorntonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility215 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF215 records

DNA & barcodingNCBIsequences

01Narrative

Xanthorrhoea thorntonii, commonly known as Cundeelee grasstree, Cundeelee blackboy, desert grasstree, yacka or grasstree, is a species of grasstree of the genus Xanthorrhoea native to central Australia. It is known to the Pitjantjatjara people as kata-kultu, kata-puru, ulpa or urara, the Warlpiri people as yurlurnkuru and the Arrernte as lunkere. X. thorntonii is the only grass tree found in Central Australia including the Great Sandy Desert, Great Victoria Desert and MacDonnell Ranges.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Fruit length22.5 mm

Leaf width2.1 mm

Plant height5 m

Plant height max5 m

Seed length15 mm

Seed mass66.87 mg

Seed width7.25 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typewind

Flowering timennnnnnnnyyyy

Life formshrub or tree

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: herb

Leaf compoundnesssimple

Leaf shaperhomboidal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density395 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea thorntonii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399391.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea thorntonii voucher MELUM125663a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type215 records

Wild obs. + sensor35

Museum / vouchered174

Cultivated / captive6

Origin

Native34

Range

Area of Occupancy AOO420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 9≤1 km 9≤10 km 6>10 km 1

25 georeferenced · 10 without coordinates

Open the mapobservation + sensor35

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 18≤1 km 29≤10 km 70>10 km 14

131 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence174

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 2 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	36
Kensington, AU	34
Canberra, AU	31
Mount Annan, AU	22
Adelaide, AU	20
Museo Entomologico de Leonlocation not on record	15
Brisbane, AU	6
BGPAlocation not on record	6
Zürich, CH	2
Parkville, AU	1

10 institutions · 173 of 174 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)