Xanthorrhoea semiplana

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records4 249

Data sources8

Biological traits30

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Xanthorrhoea semiplana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 249 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF4 249 records

DNA & barcodingNCBIsequences

01Narrative

Kangaroo Island grass tree (Xanthorrhoea semiplana tateana). Cape Cassini, Kangaroo Island, South Australia. Kangaroo Island grass tree (Xanthorrhoea semiplana tateana). Stokes Bay, Kangaroo Island, South Australia. Xanthorrhoea semiplana is a species of grass tree found in south-eastern Australia. It has two subspecies: Xanthorrhoea semiplana ssp. semiplana – Tufted grass tree, found on the Eyre, Yorke and Fleurieu Peninsulas, south-eastern South Australia and probably central-western Victoria Xanthorrhoea semiplana ssp. tateana – Kangaroo Island grass tree, Tate's grass tree or Yakka Bush

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length15.5 mm

Leaf mass per area417 g/m2

Leaf width8.5 mm

Plant height6 m

Seed length10.5 mm

Seed mass16.38 mg

Seed mass max17.12 mg

Seed mass min15.64 mg

Seed width5.5 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering timennnnnnnnnyyn

Life formshrub or tree

Life spanperennial

Pollination syndromeinsect

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: herb

Leaf compoundnesssimple

Leaf shapeobtriangular rhomboidal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Xanthorrhoea semiplana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Acyl phloroglucinols1

Phenanthrenes1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
8-Methoxy-2-methyl-2,3-dihydrobenzo[g][1]benzofuran		present	LOTUS
Xanthoxylin		present	LOTUS

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea semiplana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399383.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea semiplana isolate TM144 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type4 249 records

Wild obs. + sensor4 208

Museum / vouchered39

Cultivated / captive2

Origin

Native2 429

Range

Area of Occupancy AOO3 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 678≤1 km 1 574≤10 km 191>10 km 62

3 505 georeferenced · 703 without coordinates

Open the mapobservation + sensor4 208

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 10≤1 km 6≤10 km 12>10 km 5

33 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence39

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	23
Parkville, AU	5
Museo Entomologico de Leonlocation not on record	2
Mount Annan, AU	1
Brisbane, AU	1
Chicago, US	1
Auckland, NZ	1

7 institutions · 34 of 39 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea semiplana

At a glance

Sources8 archives

Size & morphology9

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

Compound class profile2 classes

Documented compounds2 total

At a glance

Record type4 249 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 7 geolocated

Cultivated / Captivenot free-living

Record type4 249 records