Xanthorrhoea pumilio

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records81

Data sources5

Biological traits17

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Xanthorrhoea pumilio's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF81 records

DNA & barcodingNCBIsequences

01Narrative

Xanthorrhoea pumilio is a species of grasstree of the genus Xanthorrhoea native to Queensland. The perennial grass tree typically grows to a height of 2 to with the trunk reaching 0.6 m, scape of 0.5 to and the flower spike to 0.5 m. It blooms between April and May producing cream-white flowers. The species is found along the east coast of Queensland from Cooktown south to Gladstone and as afar west as the Great Dividing Range.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology2

Leaf width2 mm

Plant height0.6 m

Life cycle & reproduction5

Flowering timennnyynnnnnnn

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: herb · TRY: herb

Leaf compoundnesssimple

Leaf shapelinear obtriangular obtrullate

Woodinessnon-woody

⚠ sources differ — AusTraits: herbaceous · GIFT: woody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea pumilio has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399369.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea pumilio voucher NSW230532 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type81 records

Wild obs. + sensor18

Museum / vouchered56

Other7

Origin

Native29

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 4≤1 km 4≤10 km 2>10 km 3

13 georeferenced · 5 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 12≤1 km 11≤10 km 20>10 km 9

52 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	29
Museo Entomologico de Leonlocation not on record	13
Brisbane, AU	7
Parkville, AU	4
Canberra, AU	3

5 institutions · 56 of 56 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)