Xanthorrhoea preissii

Endl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records2 885

Data sources13

Biological traits29

DNA specimens1

eDNA detections165

Sources13 archives

Databases and archives Xanthorrhoea preissii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 885 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI165 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Chemical compositionLOTUS · NPASS158 compounds

Occurrence & distributionGBIF2 885 records

Environmental DNA3 datasets · 1 countries165 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Xanthorrhoea preissii, known as balga, is a widespread species of perennial monocot in Southwest Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology7

Leaf length675 mm

Leaf mass per area454 g/m2

Leaf size1 671 mm²

Leaf width2.5 mm

Plant height3 m

Plant height max5 m

Seed mass15.59 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timeyyyyyyyyyyyn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: palmoid · TRY: S

Leaf compoundnesssimple

Leaf shaperhomboidal

Woodinesswoody

⚠ sources differ — TRY: W · AusTraits: woody_like_stem · GIFT: woody

Physiology & chemistry4

Leaf n7.75 mg/g

Leaf p0.239 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition158 compounds

Compounds documented for Xanthorrhoea preissii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives13

Flavanones7

Chalcones5

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids4

Spirostane steroids4

Documented compounds158 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Corlumine	present	LOTUS
(+)-Lupanine	present	LOTUS
(-)-Hydrastine	present	LOTUS
(-)-Menthol	present	LOTUS
(2E,4E,6E)-5-(acetyloxymethyl)tetradeca-2,4,6-trienoic acid	present	LOTUS
(2S)-2-hydroxy-2-[[(E)-3-(4-hydroxyphenyl)prop-2-enoyl]oxymethyl]butanedioic acid	present	NPASS
(2S)-2-hydroxy-2-[[(Z)-3-(4-hydroxyphenyl)prop-2-enoyl]oxymethyl]butanedioic acid	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-4-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'S,6R,7S,8R,9S,12S,13R,16S)-5'-(hydroxymethyl)-7,9,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-4-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-2-[[(1S,2S,4S,6S,7S,8R,9S,12S,13R,16S)-6-methoxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-16-yl]oxy]-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea preissii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences8

eDNA detections165

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399366.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea preissii isolate TM086 voucher MELUM125730a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Xanthorrhoea preissii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +1

CCDB · ipcn-api-dl — Hanson, L., R. L. Brown, A. Boyd, M. A. T. Johnson & M. D. Bennett. 2003. First nuclear DNA C-values for 28 angiosperm genera. Ann. Bot. (Oxford) 91: 31–38.

CCDB · book-fedorov — Waterhouse (D. 1955)

CCDB · book-atlas-flowering-plants

CCDB · kew — Hanson L, Brown RL, Boyd A, Johnson MAT, Bennett MD. 2003. First nuclear DNA C-values for 28 angiosperm genera. Annals of Botany 91: 1-8

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 885 records

Wild obs. + sensor2 482

Museum / vouchered399

Cultivated / captive4

Origin

Native48

Range

Area of Occupancy AOO4 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 558≤1 km 464≤10 km 86>10 km 56

2 164 georeferenced · 318 without coordinates

Open the mapobservation + sensor2 482

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 115≤1 km 23≤10 km 42>10 km 6

186 georeferenced · 213 without coordinates

Open the institutions mapphysical evidence399

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 3 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	169
Mount Annan, AU	27
Canberra, AU	10
Museo Entomologico de Leonlocation not on record	8
Parkville, AU	6
Adelaide, AU	5
BGPAlocation not on record	3
BRNUlocation not on record	2
John T. Waterhouse Herbariumlocation not on record	1
Brisbane, AU	1
Claremont, US	1
Auckland, NZ	1
China Agricultural Universitylocation not on record	1

13 institutions · 235 of 399 vouchered records shown · 164 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA165 detections

Where the DNA of Xanthorrhoea preissii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found165

Studies independent surveys3

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 165 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature17.0 °C 9.00–28.0

pH5.70 3.60–8.70

Conductivity25.0 µS/cm 10.0–32,040

Organic carbon1.12 % 0.003–4.96

Water content4.96 % 0.816–29.6

Nitrate-N3.00 mg/kg 0.277–35.0

Phosphorus4.00 mg/kg 2.00–187

Clay7.92 % 0.94–54.4

Sand88.1 % 39.8–99.1

Depth0.1 m 0–2.00

Coastal waterSoilTenosolsSodosolChromosolsKandosolOrganosolRudosol

164 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 12.7–20.4

Seasonal swing summer↔winter11.6 °C

Max temp (day)20.9 °C 16.9–27.2

Min temp (night)12.6 °C 8.00–16.4

Precipitation80.7 mm/mo 23.1–123

Air humidity56.5 % 51.8–59.8

Moisture balance-30.1 mm/mo -137–38.8

Vapour deficit821 Pa 590–1,169

Wind speed3.40 m/s 2.50–5.10

Cloud cover17.2 % 7.60–24.5

CHELSA 1981–2010, ~9 km grid, at location & month of 164 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea preissii

At a glance

Sources13 archives

Size & morphology7

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Compound class profile5 classes

Documented compounds158 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 885 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 885 records