Xanthorrhoea minor

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records750

Data sources11

Biological traits33

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Xanthorrhoea minor's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility750 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Chemical compositionLOTUS · NPASS6 compounds

Occurrence & distributionGBIF750 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Xanthorrhoea minor is a species of grasstree of the genus Xanthorrhoea native to south-eastern Australia. It was one of the many species authored by the Scottish botanist Robert Brown. Unlike some other species of grasstree, it lacks a trunk, and its leaves grow from one or more underground stems. The leaves are green. It flowers from October to November. Two subspecies are currently recognised: X. minor subsp. lutea from South Australia and Victoria X. minor subsp. minor from New South Wales, which grows in wet poorly drained areas such as swamps around the Sydney Basin, north to Gosford, and west to Springwood and south to Campbelltown.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Fruit length12 mm

Leaf mass per area555 g/m2

Leaf size322 mm²

Leaf width2.7 mm

Leaf width max3.5 mm

Leaf width min1.9 mm

Seed length8 mm

Seed width3.5 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typewind

Flowering endApr

Flowering startMar

Flowering timennnnnnnnnyyn

Life formperennial

Life spanperennial

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeobtriangular

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Xanthorrhoea minor across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavanones1

Flavones1

Aurones1

Isoflavones1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
1-[(3S)-7-hydroxy-3-methyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8,10-pentaen-6-yl]ethanone	present	LOTUS
7-Hydroxyflavone	present	NPASS
Calycosin	present	NPASS
Liquiritigenin	present	NPASS
MSEFXJHDXJYSIH-AJQSDSOLSA-N	present	NPASS
Sulfuretin	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea minor has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences9

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399356.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea minor isolate TM164b voucher MELUM125778a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS8

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Xanthorrhoea minor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-ipcn66 · CCDB · book-fedorov

CCDB · book-ipcn66 — Briggs 1966

CCDB · book-fedorov — Briggs 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type750 records

Wild obs. + sensor710

Museum / vouchered37

Cultivated / captive3

Origin

Native6

Introduced2

Range

Area of Occupancy AOO1 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 485≤1 km 89≤10 km 37>10 km 26

637 georeferenced · 73 without coordinates

Open the mapobservation + sensor710

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 1≤1 km 6≤10 km 13>10 km 5

25 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence37

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Parkville, AU	10
Mount Annan, AU	6
Brisbane, AU	6
La Trobe Universitylocation not on record	5
Auckland, NZ	3
Museo Entomologico de Leonlocation not on record	3
Smithfield, AU	1
Palmerston, AU	1
EL PASO, US	1
John T. Waterhouse Herbariumlocation not on record	1

10 institutions · 37 of 37 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Xanthorrhoea minor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)