Xanthorrhoea media

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records3 013

Data sources12

Biological traits33

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Xanthorrhoea media's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 013 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF3 013 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Xanthorrhoea media, known as a Grass Tree, or Gulgadya in the Cadigal language, is a mid-sized plant in the genus Xanthorrhoea. The specific epithet media (meaning "middle") is from the Latin, and refers to the fact that this species is in the middle of the taxonomic range for this group.Les Robinson - Field Guide to the Native Plants of Sydney, page 278 This perennial shrub is found in heathland or eucalyptus forest on sandstone. It occurs most often in dry sites such as exposed ridges and the sides of hills. The distribution is from near Sydney to the Blue Mountains. This plant usually has no trunk, or only a small trunk about 30 cm (12 in) high, under the skirt of leaves. It may grow to 2.5 metres (8 ft) tall. The leaves are a mid to dark green, but not glaucous. Flowering occurs between August and March, dependent on fire. This species first appeared in the scientific literature in 1810, in the Prodromus Florae Novae Hollandiae, authored by the prolific Scottish botanist, Robert Brown.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf mass183 mg

Leaf mass per area478 g/m2

Leaf size845 mm²

Leaf width2.6 mm

Leaf width max2.8 mm

Leaf width min2 mm

Plant height1 m

⚠ sources differ — AusTraits: 1 m · TRY: 0.75 m

Plant height max0.3 m

Seed mass9.23 mg

⚠ sources differ — TRY: 9.23 mg · AusTraits: 10.31 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typeself

Flowering endMar

Flowering startAug

Flowering timeyyynnnnyyyyy

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shaperhomboidal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)1.97 mm²/mg

03Chemical composition26 compounds

Compounds documented for Xanthorrhoea media across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavan-3-ols15

Proanthocyanins8

Flavan-3-ols $ Proanthocyanins1

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R)-5,7-Diacetoxy-2-(3,4,5-Triacetoxyphenyl)-3,4-Dihydro-2H-Chromen-3-Yl 3,4,5-Triacetoxybenzoate	present	NPASS
(2R,3R)-6-[(2R,3S,4S)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3R)-8-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3R)-8-[(2R,3S,4S)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3S)-6-[(2R,3S,4R)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2R,3S)-6-[(2R,3S,4S)-3,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-2-(3,4,5-trihydroxyphenyl)-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(4alpha->8)-bis-4'-O-methylgallocatechin	present	NPASS
1-[(3S)-7-hydroxy-3-methyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8,10-pentaen-6-yl]ethanone	present	LOTUS
4'-O-Methyl-Gallocatechin	present	NPASS
[(2R,3R)-5,7-diacetyloxy-2-(3,4,5-triacetyloxyphenyl)-3,4-dihydro-2H-chromen-3-yl] 4-acetyloxy-3,5-dimethoxybenzoate	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea media has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399350.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea media isolate TM025 voucher MELUM125682a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Xanthorrhoea media carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Waterhouse (D. 1955)

CCDB · book-fedorov — Briggs 1966

CCDB · book-atlas-flowering-plants — J. T. Waterhouse unp. T

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~1.46 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.46 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type3 013 records

Wild obs. + sensor2 908

Museum / vouchered103

Cultivated / captive2

Origin

Native76

Range

Area of Occupancy AOO4 236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 2 335≤1 km 325≤10 km 129>10 km 8

2 797 georeferenced · 111 without coordinates

Open the mapobservation + sensor2 908

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 8≤1 km 38≤10 km 45>10 km 7

98 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence103

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	76
Canberra, AU	12
Adelaide, AU	4
Parkville, AU	2
Brisbane, AU	2
Armidale, AU	2
Wollongong, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Austin, US	1
Bloomington, US	1

11 institutions · 103 of 103 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Xanthorrhoea media was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea media

At a glance

Sources12 archives

Size & morphology9

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Compound class profile3 classes

Documented compounds26 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type3 013 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 11 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type3 013 records