Xanthorrhoea macronema

F.Muell. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records1 579

Data sources8

Biological traits28

DNA specimens6

eDNA detections2

Sources8 archives

Databases and archives Xanthorrhoea macronema's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 579 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF1 579 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 22

01Narrative

مصفورة كبيرة الأسدية هي نوع من النباتات يتبع جنس المصفورة من فصيلة المصفورية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology6

Leaf width2.9 mm

Leaf width max3.5 mm

Leaf width min2.3 mm

Seed mass25.33 mg

Seed mass max25.46 mg

Seed mass min25.46 mg

Life cycle & reproduction9

Deciduousnessevergreen

Flowering endJan

Flowering startJul

Flowering timeynnnnnyyyyyy

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeobtriangular obtrullate

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea macronema has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences7

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL536700.1 ↗364 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGTGCCCGAGGCCATCCGGTCGAGGGCACGCCTGCCTGGGCGTCATGCCTC …

Xanthorrhoea macronema voucher MO:Carlsen3466 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Xanthorrhoea macronema carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-ipcn66

CCDB · book-ipcn66 — Briggs 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 579 records

Wild obs. + sensor1 341

Museum / vouchered184

Cultivated / captive2

Fossil2

Other50

Origin

Native55

Range

Area of Occupancy AOO3 520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 982≤1 km 175≤10 km 49>10 km 24

1 230 georeferenced · 111 without coordinates

Open the mapobservation + sensor1 341

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 21≤1 km 32≤10 km 64>10 km 34

151 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence184

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	55
Brisbane, AU	47
Museo Entomologico de Leonlocation not on record	21
Armidale, AU	14
Canberra, AU	10
Adelaide, AU	8
Parkville, AU	6
NSW Dept of Planning, Industry and Environmentlocation not on record	6
John T. Waterhouse Herbariumlocation not on record	6
University of Stellenboschlocation not on record	3
Kew, GB	1
Chicago, US	1
Hobart, AU	1
Saint Louis, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
University of the Sunshine Coastlocation not on record	1

16 institutions · 182 of 184 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Xanthorrhoea macronema was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 14.5–21.7

Seasonal swing summer↔winter17.5 °C

Max temp (day)22.1 °C 20.0–24.2

Min temp (night)14.5 °C 9.80–19.2

Precipitation118 mm/mo 115–121

Air humidity57.0 % 55.0–58.9

Vapour deficit908 Pa 749–1,068

Cloud cover32.6 % 23.1–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea macronema

At a glance

Sources8 archives

Size & morphology6

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 579 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 579 records