Xanthorrhoea latifolia

(A.T.Lee) D.J.Bedford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records1 158

Data sources10

Biological traits26

DNA specimens3

eDNA detections1

Sources10 archives

Databases and archives Xanthorrhoea latifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 158 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF1 158 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Xanthorrhoea latifolia is a species of grasstree of the genus Xanthorrhoea native to New South Wales and Queensland. Usually found growing in sandy or gravelly soil in the coastal regions of eastern Australia north from Wyong, New South Wales up to Cairns Queensland. The trunk of this grass tree is either absent or can grow over 3.5 metres high.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology6

Leaf width6.2 mm

Leaf width max10 mm

Leaf width min2.4 mm

Plant height3.6 m

Plant height max3.6 m

Seed mass9.06 mg

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timennynnnnnnynn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeobtriangular rhomboidal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Xanthorrhoea latifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Chalcones2

Flavanones1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
1-[(3S)-7-hydroxy-3-methyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8,10-pentaen-6-yl]ethanone	present	LOTUS
Chalcone	present	LOTUS
Cinnamoylbenzene	present	LOTUS
Liquiritigenin	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea latifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399336.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea latifolia isolate TM046 voucher MELUM125699a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Xanthorrhoea latifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-ipcn66

CCDB · book-ipcn66 — Briggs 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 158 records

Wild obs. + sensor910

Museum / vouchered35

Cultivated / captive1

Other212

Origin

Native5

Range

Area of Occupancy AOO2 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 715≤1 km 95≤10 km 16>10 km 20

846 georeferenced · 64 without coordinates

Open the mapobservation + sensor910

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 9≤1 km 3≤10 km 8>10 km 2

22 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence35

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Parkville, AU	7
Mount Annan, AU	5
Armidale, AU	5
Canberra, AU	4
Brisbane, AU	3
James Cook Townsvillelocation not on record	2
Adelaide, AU	2
Museo Entomologico de Leonlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
University of the Sunshine Coastlocation not on record	1

10 institutions · 31 of 35 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Xanthorrhoea latifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter10.3 °C

Max temp (day)26.9 °C

Min temp (night)17.5 °C

Precipitation118 mm/mo

Air humidity60.1 %

Moisture balance-40.4 mm/mo

Vapour deficit1,044 Pa

Wind speed2.50 m/s

Cloud cover21.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea latifolia

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

Compound class profile2 classes

Documented compounds4 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 158 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 10 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 158 records