Xanthorrhoea johnsonii

A.T.Lee · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records4 531

Data sources9

Biological traits35

DNA specimens2

eDNA detections1

Sources9 archives

Databases and archives Xanthorrhoea johnsonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 531 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF4 531 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Xanthorrhoea johnsonii in Australian National Botanic Gardens Xanthorrhoea johnsonii (also known as Johnson's Grass Tree) is a large plant in the genus Xanthorrhoea found in eastern Australia. The trunk can grow to 5 metres tall. Older foliage is very strong, hence one of the common names being "steel grass", and is commonly used in floral design where it can be bent and looped without breaking. It was named after the Australian botanist L.A.S. Johnson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf width1.75 mm

Leaf width max2.5 mm

Leaf width min1 mm

Plant height5 m

Plant height max5 m

Plant height min0.1 m

Seed mass17.04 mg

⚠ sources differ — TRY: 17.04 mg · AusTraits: 18 mg · GIFT: 16.09 mg

Seed mass max18.05 mg

Seed mass min14.13 mg

Life cycle & reproduction13

Deciduousnessevergreen

Dispersal typeself

Flowering endDec

Flowering startApr

Flowering timennnyyyyyyyyy

Life formshrub

Life spanperennial

Lifespan years250 years

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — AusTraits: herb · TRY: shrub

Leaf compoundnesssimple

Leaf shaperhomboidal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition4 compounds

Compounds documented for Xanthorrhoea johnsonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Chalcones2

Flavanones1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
1-[(3S)-7-hydroxy-3-methyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8,10-pentaen-6-yl]ethanone	present	LOTUS
Chalcone	present	LOTUS
Cinnamoylbenzene	present	LOTUS
Liquiritigenin	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea johnsonii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399329.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea johnsonii isolate TM051 voucher MELUM125703a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8

plant barcodefungal barcode

08Occurrence & distribution

Record type4 531 records

Wild obs. + sensor3 201

Museum / vouchered486

Cultivated / captive7

Other837

Origin

Native111

Range

Area of Occupancy AOO9 592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 2 513≤1 km 137≤10 km 208>10 km 58

2 916 georeferenced · 285 without coordinates

Open the mapobservation + sensor3 201

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 115≤1 km 107≤10 km 134>10 km 55

411 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence486

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 1>10 km 2

5 georeferenced · 2 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	178
Mount Annan, AU	109
Canberra, AU	57
Smithfield, AU	41
Armidale, AU	27
Museo Entomologico de Leonlocation not on record	17
NSW Dept of Planning, Industry and Environmentlocation not on record	16
James Cook Townsvillelocation not on record	7
Parkville, AU	7
Adelaide, AU	5
Kew, GB	3
John T. Waterhouse Herbariumlocation not on record	3
Auckland, NZ	3
Copenhagen, DK	2
Clocation not on record	1
Hobart, AU	1
Claremont, US	1
Philadelphia, US	1
University of the Sunshine Coastlocation not on record	1
Burlington, US	1

20 institutions · 481 of 486 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Xanthorrhoea johnsonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–21.1

Seasonal swing summer↔winter8.90 °C

Max temp (day)24.2 °C

Min temp (night)18.2 °C

Precipitation94.2 mm/mo

Air humidity58.4 %

Moisture balance-80.4 mm/mo

Vapour deficit1,033 Pa

Wind speed5.20 m/s

Cloud cover19.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea johnsonii

At a glance

Sources9 archives

Size & morphology9

Life cycle & reproduction13

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Compound class profile2 classes

Documented compounds4 total

At a glance

Record type4 531 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 531 records