Xanthorrhoea glauca

D.J.Bedford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records995

Data sources8

Biological traits34

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Xanthorrhoea glauca's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility995 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF995 records

DNA & barcodingNCBIsequences

01Narrative

Xanthorrhoea glauca, known as the grass tree, is a large plant in the genus Xanthorrhoea, widespread in eastern Australia. The trunk can grow in excess of 5 metres tall, and may be many branched. It is occasionally seen in large communities in nutrient rich soils. The leaves are a grey or bluish glaucous green. Two sub-species are recognised; subspecies angustifolia and glauca.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Leaf mass per area336 g/m2

Leaf size1 958 mm²

Leaf width3.15 mm

Leaf width max5 mm

Leaf width min1.3 mm

Plant height5 m

Plant height max5 m

Plant height min1 m

Seed mass36.02 mg

Seed mass max36.02 mg

Seed mass min36.02 mg

Life cycle & reproduction10

Deciduousnessevergreen

Flowering endDec

Flowering startSep

Flowering timennnnnyyyyyyy

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: herb

Leaf compoundnesssimple

Leaf shaperhomboidal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition10 compounds

Compounds documented for Xanthorrhoea glauca across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavanones6

Chalcones3

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(R)-naringenin	present	LOTUS
(S)-Naringenin	present	LOTUS
1-[(3S)-7-hydroxy-3-methyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8,10-pentaen-6-yl]ethanone	present	LOTUS
7-O-Methyl Naringenin	present	LOTUS
Chalcone	present	LOTUS
Cinnamoylbenzene	present	LOTUS
Isoliquiritigenin	present	LOTUS
Liquiritigenin	present	LOTUS
Naringenin 5-methyl ether	present	LOTUS
Sakuranetin	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea glauca has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399313.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea glauca isolate TM195 voucher MELUM125795a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type995 records

Wild obs. + sensor942

Museum / vouchered21

Cultivated / captive5

Other27

Origin

Native6

Introduced3

Range

Area of Occupancy AOO2 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 692≤1 km 101≤10 km 32>10 km 18

843 georeferenced · 99 without coordinates

Open the mapobservation + sensor942

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 4≤10 km 4

8 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence21

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy40% within 1 km

≤1 km 2≤10 km 3

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Parkville, AU	9
Mount Annan, AU	6
Armidale, AU	4
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Brisbane, AU	1

5 institutions · 21 of 21 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)