Xanthorrhoea fulva

(A.T.Lee) D.J.Bedford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records1 430

Data sources8

Biological traits23

DNA specimens3

eDNA detections1

Sources8 archives

Databases and archives Xanthorrhoea fulva's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 430 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources23 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF1 430 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Xanthorrhoea fulva is a species of grasstree of the genus Xanthorrhoea native to New South Wales and Queensland. It was previously regarded as a subspecies of Xanthorrhoea resinosa, but reclassified as a species in its own right in 1986. Unlike some other grasstrees, it lacks a trunk, and instead grows from one or more underground stems. The leaves are blue-green or blue-grey and depressed in cross section. It flowers from August to October. Xanthorrhoea fulva grows in wet sandy areas from Wyong on the New South Wales Central Coast north to around Rockhampton in Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology2

Leaf width2.7 mm

Seed mass7.38 mg

Life cycle & reproduction8

Deciduousnessevergreen

Flowering timennnnnnnyyynn

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeobtriangular obtrullate

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: non-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition3 compounds

Compounds documented for Xanthorrhoea fulva across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavanones2

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(R)-naringenin	present	LOTUS
(S)-Naringenin	present	LOTUS
1-[(3S)-7-hydroxy-3-methyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8,10-pentaen-6-yl]ethanone	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea fulva has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences9

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399302.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea fulva isolate TM199 voucher MELUM125799a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS7trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 430 records

Wild obs. + sensor1 152

Museum / vouchered121

Cultivated / captive1

Fossil1

Other155

Origin

Native42

Range

Area of Occupancy AOO2 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 960≤1 km 76≤10 km 22>10 km 10

1 068 georeferenced · 84 without coordinates

Open the mapobservation + sensor1 152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 19≤1 km 29≤10 km 34>10 km 23

105 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence121

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	42
Brisbane, AU	36
Canberra, AU	16
Museo Entomologico de Leonlocation not on record	10
Parkville, AU	6
Armidale, AU	6
Adelaide, AU	3
NSW Dept of Planning, Industry and Environmentlocation not on record	1
University of the Sunshine Coastlocation not on record	1

9 institutions · 121 of 121 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Xanthorrhoea fulva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 21.1–21.1

Seasonal swing summer↔winter8.90 °C

Max temp (day)24.2 °C

Min temp (night)18.2 °C

Precipitation94.2 mm/mo

Air humidity58.4 %

Moisture balance-80.4 mm/mo

Vapour deficit1,033 Pa

Wind speed5.20 m/s

Cloud cover19.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea fulva

At a glance

Sources8 archives

Size & morphology2

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

Compound class profile1 class

Documented compounds3 total

At a glance

Record type1 430 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 9 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 430 records