Xanthorrhoea concava

(A.T.Lee) D.J.Bedford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records1 429

Data sources5

Biological traits28

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Xanthorrhoea concava's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 429 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF1 429 records

DNA & barcodingNCBIsequences

01Narrative

Xanthorrhoea concava is a species of grasstree native to New South Wales, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology2

Leaf width4.5 mm

Seed mass8.8 mg

Life cycle & reproduction12

Deciduousnessevergreen

Dispersal typeself

Flowering endDec

Flowering startOct

Flowering timennnnnnnnnyyy

Life formperennial

Life spanperennial

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeobtriangular

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea concava has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399292.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea concava isolate TM285 voucher MELUM125815a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type1 429 records

Wild obs. + sensor1 318

Museum / vouchered99

Cultivated / captive12

Origin

Native53

Range

Area of Occupancy AOO3 256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 154≤1 km 81≤10 km 17>10 km 3

1 255 georeferenced · 63 without coordinates

Open the mapobservation + sensor1 318

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 18≤1 km 36≤10 km 38>10 km 1

93 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence99

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy42% within 1 km

≤100 m 2≤1 km 3≤10 km 7

12 georeferenced

Open the mapnot free-living12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	53
Canberra, AU	28
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Parkville, AU	3
Museo Entomologico de Leonlocation not on record	3
Batemans Bay, AU	3
Adelaide, AU	2
Wollongong, AU	1
Brisbane, AU	1
Armidale, AU	1

10 institutions · 99 of 99 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea concava

At a glance

Sources5 archives

Size & morphology2

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Record type1 429 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 10 geolocated

Cultivated / Captivenot free-living

Record type1 429 records