Xanthorrhoea caespitosa

D.J.Bedford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records3 741

Data sources5

Biological traits28

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Xanthorrhoea caespitosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 741 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF3 741 records

DNA & barcodingNCBIsequences

01Narrative

Xanthorrhoea caespitosa, commonly known as sand-heath grasstree, is a species of grasstree of the genus Xanthorrhoea native to South Australia. The perennial grass tree is found in the south east of South Australia. and the south of the Northern Territory

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology7

Fruit length14 mm

Leaf width5.1 mm

Seed length9 mm

Seed mass8.82 mg

Seed mass max8.82 mg

Seed mass min8.82 mg

Seed width4 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering timennnnnnnnnyyy

Life formperennial

Life spanperennial

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: shrub

Leaf compoundnesssimple

Leaf shapeobtriangular

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea caespitosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399282.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea caespitosa isolate TM007 voucher MELUM125670a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type3 741 records

Wild obs. + sensor3 594

Museum / vouchered145

Cultivated / captive2

Origin

Native2 840

Range

Area of Occupancy AOO6 424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 1 244≤1 km 1 711≤10 km 495>10 km 8

3 458 georeferenced · 136 without coordinates

Open the mapobservation + sensor3 594

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 14≤1 km 41≤10 km 56>10 km 26

137 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence145

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	94
Mount Annan, AU	15
Museo Entomologico de Leonlocation not on record	14
Parkville, AU	8
Canberra, AU	5
Brisbane, AU	2

6 institutions · 138 of 145 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea caespitosa

At a glance

Sources5 archives

Size & morphology7

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

At a glance

Record type3 741 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions5 of 6 geolocated

Cultivated / Captivenot free-living

Record type3 741 records