Xanthorrhoea australis

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records7 153

Data sources11

Biological traits40

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Xanthorrhoea australis's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Chemical compositionLOTUS29 compounds

Occurrence & distributionGBIF7 153 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Grasstrees at Wilsons Promontory Xanthorrhoea australis, the grass tree, austral grasstree or blackboy, is an Australian plant. It is the most commonly seen species of the genus Xanthorrhoea. Its trunk can grow up to several metres tall and is often branched. In certain Aboriginal languages, it is called bukkup, baggup or kawee.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length17 mm

Leaf length1 400 mm

Leaf size3 299 mm²

Leaf width3 mm

Plant height4 m

Plant height max3 m

Seed length7.83 mm

Seed mass12.74 mg

Seed mass max12.74 mg

Seed mass min12.74 mg

Seed width3.5 mm

Life cycle & reproduction13

Deciduousnessevergreen

Dispersal typeself

Flowering endDec

Flowering startJul

Flowering timennnnnnyyyyyy

Life formshrub

Life spanperennial

Lifespan years300 years

⚠ sources differ — TRY: 300 years · AusTraits: 175 years

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproductive maturity25.5 years

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — AusTraits: herb · TRY: shrub

Leaf compoundnesssimple

Leaf shapeobtrullate rhomboidal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry5

Leaf n4.7 mg/g

Leaf p0.14 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)1.8 mm²/mg

03Chemical composition29 compounds

Compounds documented for Xanthorrhoea australis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives8

Chalcones7

Flavanones5

Flavones2

Anthraquinones and anthrones2

Documented compounds29 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,4R)-3-methyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8,10-pentaene-4,7-diol	present	LOTUS
(E)-3-(2,4-dihydroxyphenyl)-1-(3,4-dimethoxyphenyl)prop-2-en-1-one	present	LOTUS
1-(3,5-Dihydroxy-4-methoxyphenyl)-3-(2-hydroxy-4-methoxyphenyl)prop-2-en-1-one	present	LOTUS
1-[(3S)-7-hydroxy-3-methyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8,10-pentaen-6-yl]ethanone	present	LOTUS
2,3-Dihydro-2-methylnaphtho[1,8-bc]pyran-5-ol	present	LOTUS
2-Propen-1-one, 1-(2-hydroxy-4-methoxyphenyl)-3-(4-hydroxyphenyl)-	present	LOTUS
2-Propenoic acid, 3-phenyl-	present	LOTUS
2-Propenoic acid, 3-phenyl-, 3-phenyl-2-propenyl ester	present	LOTUS
2-Propenoic acid, 3-phenyl-, methyl ester	present	LOTUS
3-(2-Hydroxy-4,6-dimethoxyphenyl)-1-phenylprop-2-en-1-one	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea australis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399259.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea australis isolate TM141 voucher MELUM125764a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Xanthorrhoea australis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · ipcn-api-dl · CCDB · book-ipcn66

CCDB · ipcn-api-dl — Wiltshire, R. J. E. & W. D. Jackson. 2003. Index of chromosome numbers of Tasmanian spermatophytes. Pap. & Proc. Roy. Soc. Tasmania 137: 39–53.

CCDB · book-ipcn66 — Briggs 1966

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wiltshire, R. J. E. & W. D. Jackson. 2003. Index of chromosome numbers of Tasmanian spermatophytes. Pap. & Proc. Roy. Soc. Tasmania 137: 39–53.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 153 records

Wild obs. + sensor6 908

Museum / vouchered236

Cultivated / captive9

Origin

Native262

Range

Area of Occupancy AOO9 464 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 4 557≤1 km 1 458≤10 km 275>10 km 75

6 365 georeferenced · 543 without coordinates

Open the mapobservation + sensor6 908

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 17≤1 km 48≤10 km 91>10 km 8

164 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence236

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2>10 km 2

5 georeferenced · 4 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	55
QVMAGlocation not on record	46
Museo Entomologico de Leonlocation not on record	38
Adelaide, AU	31
Hobart, AU	18
Canberra, AU	18
Parkville, AU	14
Armidale, AU	3
Bronx, US	2
Wellington, NZ	1
Kew, GB	1
University of Stellenboschlocation not on record	1
South Kensington, GB	1
Moscow, US	1
Palmerston, AU	1
Batemans Bay, AU	1

16 institutions · 232 of 236 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Xanthorrhoea australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea australis

At a glance

Sources11 archives

Size & morphology11

Life cycle & reproduction13

Diet & foraging1

Habitat & environment10

Physiology & chemistry5

Compound class profile5 classes

Documented compounds29 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type7 153 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type7 153 records