Xanthorrhoea arenaria

D.J.Bedford · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records170

Data sources7

Biological traits17

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Xanthorrhoea arenaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility170 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF170 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Xanthorrhoea arenaria, the sandy grasstree, is a species of grasstree endemic to Tasmania, Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology2

Leaf width2.5 mm

Seed mass3.63 mg

Life cycle & reproduction5

Flowering timeynnnnyyyyyyy

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeobtriangular obtrullate

Woodinesswoody

⚠ sources differ — TRY: W · AusTraits: herbaceous · GIFT: woody

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea arenaria has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399251.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea arenaria voucher HO551982 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Xanthorrhoea arenaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wiltshire, R. J. E. & W. D. Jackson. 2003. Index of chromosome numbers of Tasmanian spermatophytes. Pap. & Proc. Roy. Soc. Tasmania 137: 39–53.

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wiltshire, R. J. E. & W. D. Jackson. 2003. Index of chromosome numbers of Tasmanian spermatophytes. Pap. & Proc. Roy. Soc. Tasmania 137: 39–53.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type170 records

Wild obs. + sensor106

Museum / vouchered64

Origin

Native17

Range

Area of Occupancy AOO244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 94≤1 km 7≤10 km 5

106 georeferenced

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 1≤1 km 44≤10 km 12>10 km 1

58 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Hobart, AU	36
Mount Annan, AU	17
Museo Entomologico de Leonlocation not on record	3
Parkville, AU	2
QVMAGlocation not on record	2
John T. Waterhouse Herbariumlocation not on record	1
Kew, GB	1
Armidale, AU	1
Canberra, AU	1

9 institutions · 64 of 64 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)