Xanthorrhoea arborea

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records1 680

Data sources9

Biological traits32

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Xanthorrhoea arborea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 680 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources32 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF1 680 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Xanthorrhoea arborea a species of grasstree of the genus Xanthorrhoea native to New South Wales and Queensland. It was one of the many species authored by the Scottish botanist Robert Brown. It grows a trunk up to 2 metres (7 ft) tall. The leaves are dull green to blue-grey, 5 to 8 mm wide. It flowers from January to April, depending on fire.Les Robinson - Field Guide to the Native Plants of Sydney, page 278 Xanthorrhoea arborea grows in dry sclerophyll forests around the Sydney Basin on the New South Wales Central Coast westwards over the Great Divide to Rylstone.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Leaf mass per area311 g/m2

Leaf size7 500 mm²

Leaf width6 mm

Leaf width max7 mm

Leaf width min5 mm

Plant height2 m

Plant height max2 m

Plant height min1 m

Seed mass14.81 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeself

Flowering endApr

Flowering startJan

Flowering timeyyyynnnnnnnn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear rhomboidal

Woodinesswoody

⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition4 compounds

Compounds documented for Xanthorrhoea arborea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Phenanthrenes1

Acyl phloroglucinols1

Flavanones1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
1-[(3S)-7-hydroxy-3-methyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8,10-pentaen-6-yl]ethanone	present	LOTUS
8-Methoxy-2-methyl-2,3-dihydrobenzo[g][1]benzofuran	present	LOTUS
Alpinetin	present	LOTUS
Xanthoxylin	present	LOTUS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea arborea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399248.1 ↗953 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea arborea isolate TM029 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Xanthorrhoea arborea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · book-ipcn66 · CCDB · book-fedorov

CCDB · book-ipcn66 — Briggs 1966

CCDB · book-fedorov — Briggs 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 680 records

Wild obs. + sensor1 590

Museum / vouchered87

Cultivated / captive3

Origin

Native44

Range

Area of Occupancy AOO2 380 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 183≤1 km 196≤10 km 78>10 km 7

1 464 georeferenced · 126 without coordinates

Open the mapobservation + sensor1 590

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 6≤1 km 12≤10 km 48>10 km 3

69 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence87

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	44
Canberra, AU	18
Museo Entomologico de Leonlocation not on record	7
Parkville, AU	6
Armidale, AU	5
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Brisbane, AU	2
Bronx, US	1
John T. Waterhouse Herbariumlocation not on record	1

9 institutions · 86 of 87 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Xanthorrhoea arborea

At a glance

Sources9 archives

Size & morphology9

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

Compound class profile3 classes

Documented compounds4 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 680 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 9 geolocated

Cultivated / Captivenot free-living

Record type1 680 records