Xanthorrhoea acanthostachya

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Xanthorrhoea

At a glance

Occurrence records144

Data sources6

Biological traits20

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Xanthorrhoea acanthostachya's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility144 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF144 records

DNA & barcodingNCBIsequences

01Narrative

Xanthorrhoea acanthostachya is a species of grasstree of the genus Xanthorrhoea native to Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology4

Leaf width2.15 mm

Plant height1.5 m

Plant height max3 m

Plant height min0.8 m

Life cycle & reproduction5

Flowering timennnnnnnyyyyn

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: palmoid · TRY: herb

Leaf compoundnesssimple

Leaf shaperhomboidal

WoodinessFibrous

⚠ sources differ — TRY: Fibrous · AusTraits: herbaceous · GIFT: woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthorrhoea acanthostachya has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW399242.1 ↗951 bpAustralia

ACGT

TCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGGGAACCGAAA …

Xanthorrhoea acanthostachya isolate TM085 voucher MELUM125729a 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type144 records

Wild obs. + sensor118

Museum / vouchered26

Origin

Native7

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 81≤1 km 14≤10 km 4>10 km 2

101 georeferenced · 17 without coordinates

Open the mapobservation + sensor118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 7≤1 km 3≤10 km 4

14 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence26

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	11
Mount Annan, AU	7
Parkville, AU	6
Canberra, AU	2

4 institutions · 26 of 26 vouchered records shown