Xanthophyllum octandrum

(F.Muell.) Domin · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Polygalaceae/Xanthophyllum

At a glance

Occurrence records628

Data sources7

Biological traits33

DNA specimens18

eDNA detections14

Sources7 archives

Databases and archives Xanthophyllum octandrum's data was compiled from.

GBIFGlobal Biodiversity Information Facility628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF628 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD · NCBI18 specimens

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology11

Fruit length15.5 mm

⚠ sources differ — AusTraits: 15.5 mm · GIFT: 12 mm

Fruit width16.5 mm

⚠ sources differ — AusTraits: 16.5 mm · GIFT: 12 mm

Leaf length130 mm

Leaf mass113 mg

Leaf mass per area98.04 g/m2

Leaf size2 518 mm²

Leaf width45 mm

Plant height30 m

⚠ sources differ — GIFT: 30 m · AusTraits: 27.5 m

Seed length12 mm

Seed mass220 mg

Seed width10 mm

Life cycle & reproduction8

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timennnnnnnnnyyy

Life formtree

Life spanperennial

Pollination syndromebee

Resprouting capacityresprouts

Sex typehermaphrodite

Habitat & environment8

Climatewet tropical

Climberself-supporting

Fruit fleshinessdry

Fruit typecapsule

⚠ sources differ — AusTraits: capsule · GIFT: berry

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical ovate

Woodinesswoody

Physiology & chemistry5

Leaf n15.48 mg/g

Leaf p0.753 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density689 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthophyllum octandrum has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes4

GenBank sequences6

eDNA detections14

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496823.1 ↗552 bpAustralia · 2013

ACGT

AGCGTTGGGTTCAAGGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Xanthophyllum octandrum isolate BATT588-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type628 records

Wild obs. + sensor21

Museum / vouchered501

Other106

Origin

Native21

Range

Area of Occupancy AOO1 236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 7≤1 km 4≤10 km 2

13 georeferenced · 8 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 49≤1 km 42≤10 km 186>10 km 52

329 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence501

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	178
Brisbane, AU	136
Canberra, AU	32
Museo Entomologico de Leonlocation not on record	31
Mount Annan, AU	21
Kew, GB	16
Palmerston, AU	12
James Cook Townsvillelocation not on record	8
Armidale, AU	7
Hobart, AU	3
Adelaide, AU	2
CSIRO, Tropical Forest Research Centrelocation not on record	1
Wellington, NZ	1
Zürich, CH	1
Parkville, AU	1
University of the Sunshine Coastlocation not on record	1
Honolulu, US	1
ASUlocation not on record	1

18 institutions · 453 of 501 vouchered records shown · 39 without an institution code

09Environmental DNA14 detections

Where the DNA of Xanthophyllum octandrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 12.2–21.1

Seasonal swing summer↔winter18.4 °C

Max temp (day)18.5 °C 18.5–24.5

Min temp (night)5.80 °C 5.80–17.0

Precipitation10.3 mm/mo 10.3–261

Air humidity48.9 % 48.9–68.7

Moisture balance-66.0 mm/mo -68.7–136

Vapour deficit731 Pa 698–776

Wind speed3.40 m/s

Cloud cover8.80 % 8.80–52.5

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)