Xanthophyllum flavescens

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Polygalaceae/Xanthophyllum

At a glance

Occurrence records899

Data sources8

Biological traits25

DNA specimens16

eDNA detections7

Sources8 archives

Databases and archives Xanthophyllum flavescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility899 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF899 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI16 specimens

01Narrative

Xanthophyllum flavescens is a plant in the family Polygalaceae. The specific epithet ' is from the Latin meaning "becoming yellow", referring to the leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height21.6 m

Plant height max36 m

Plant height min8 m

Seed volume16 mm³

Seed volume max16 mm³

Seed volume min16 mm³

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio18.62 g/g

Leaf c465 mg/g

Leaf n25.28 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)11.15 mm²/mg

Wood density642 mg/cm³

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthophyllum flavescens has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes3

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKR532727.1 ↗481 bp

ACGT

AAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCG …

Xanthophyllum flavescens isolate J683 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type899 records

Wild obs. + sensor331

Museum / vouchered568

Range

Area of Occupancy AOO1 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 222≤1 km 80≤10 km 16>10 km 1

319 georeferenced · 12 without coordinates

Open the mapobservation + sensor331

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 567 without coordinates

Open the institutions mapphysical evidence568

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	52
Kew, GB	13
Cibinong Science Center, Herbarium Bogorienselocation not on record	9
Moscow State Universitylocation not on record	2
South Kensington, GB	2
Bronx, US	1
Boise, US	1
Guilin, CN	1
University of Stellenboschlocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Pondicherry, IN	1

11 institutions · 84 of 568 vouchered records shown · 483 without an institution code

09Environmental DNA7 detections

Where the DNA of Xanthophyllum flavescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 21.8–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 25.5–29.5

Min temp (night)22.6 °C 17.4–22.6

Precipitation269 mm/mo 224–269

Air humidity68.1 % 66.9–68.1

Moisture balance133 mm/mo 106–133

Vapour deficit1,080 Pa 878–1,080

Wind speed1.20 m/s 1.20–1.50

Cloud cover57.6 % 50.6–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)