Xanthoparmelia subramigera

(Gyeln.) Hale · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Parmeliaceae/Xanthoparmelia

At a glance

Occurrence records577

Data sources7

Biological traits1

DNA specimens10

eDNA detections10

Sources7 archives

Databases and archives Xanthoparmelia subramigera's data was compiled from.

GBIFGlobal Biodiversity Information Facility577 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF577 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

03Chemical composition1 compounds

Compounds documented for Xanthoparmelia subramigera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Usnic acid and derivatives1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
d-Usnic acid		present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthoparmelia subramigera has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes2

GenBank sequences10

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ150243.1 ↗285 bpSouth Africa · 2019

ACGT

TTGGTTCCAGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACA …

Xanthoparmelia subramigera isolate P14292 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type577 records

Wild obs. + sensor10

Museum / vouchered567

Range

Area of Occupancy AOO1 572 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 2≤10 km 3>10 km 3

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 5≤1 km 47≤10 km 60>10 km 4

116 georeferenced · 451 without coordinates

Open the institutions mapphysical evidence567

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	138
Bronx, US	107
ASUlocation not on record	58
Madison, US	26
Museum of the Rockieslocation not on record	25
Olocation not on record	22
Chicago, US	22
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	19
LDlocation not on record	19
Wuzhou, CN	16
Durham, US	16
St. Paul, US	13
PHlocation not on record	13
US	12
Berlin, DE	6
ILLSlocation not on record	5
DOI/NPS, Colonial National Historical Parklocation not on record	5
Pretoria, ZA	4
FLASlocation not on record	4
Philadelphia, US	4
MeiseBGlocation not on record	4
Boise, US	2
Davis, US	2
Chapel Hill, US	2
Herb. Ramboldlocation not on record	2
Santa Barbara, US	2
University of Gdansklocation not on record	1
EL PASO, US	1
McWane Science Centerlocation not on record	1
Universidad Nacional de Colombia (UNAL)location not on record	1
Uppsala, SE	1
WTUlocation not on record	1
Mexico City, MX	1
Fort Worth, US	1
Knoxville, US	1
Columbia, US	1

36 institutions · 558 of 567 vouchered records shown · 2 without an institution code

09Environmental DNA10 detections

Where the DNA of Xanthoparmelia subramigera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.6 °C 12.6–12.6

Seasonal swing summer↔winter27.3 °C

Max temp (day)16.4 °C

Min temp (night)7.40 °C

Precipitation112 mm/mo

Air humidity58.0 %

Moisture balance21.7 mm/mo

Vapour deficit690 Pa

Wind speed2.90 m/s

Cloud cover41.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)