Xanthoparmelia pseudocongensis

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Parmeliaceae/Xanthoparmelia

At a glance

Occurrence records48

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Xanthoparmelia pseudocongensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility48 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF48 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthoparmelia pseudocongensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG695564.1 ↗560 bpKenya

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGAGAGGGGCTTCGCGCCCCCGGGGGTCTCGGCCCTCAACTCTTCACCCTTTGCGT …

Xanthoparmelia pseudocongensis voucher Kirika 3285sanger (F) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type48 records

Wild obs. + sensor1

Museum / vouchered47

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 47 records without

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	17
ASUlocation not on record	11
Bronx, US	6
St. Paul, US	3
Berlin, DE	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
University of Gdansklocation not on record	1
Herb. Ramboldlocation not on record	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
PHlocation not on record	1
Madison, US	1
US	1

12 institutions · 47 of 47 vouchered records shown