Xanthoparmelia idahoensis

Hale · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Parmeliaceae/Xanthoparmelia

At a glance

Occurrence records47

Data sources6

Biological traits1

DNA specimens7

eDNA detections7

Sources6 archives

Databases and archives Xanthoparmelia idahoensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthoparmelia idahoensis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences7

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHM578805.1 ↗522 bpUSA

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGAGAGGGGCTTCGTGCTCCCGGGGGTTTCGGCCCCTAACTCTTCACCCTTTGCGT …

Xanthoparmelia idahoensis voucher BRY 55354 18S ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type47 records

Museum / vouchered47

Range

Area of Occupancy AOO84 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence47

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Boise, US	16
DOI/NPS, Colonial National Historical Parklocation not on record	10
University of Stellenboschlocation not on record	3
ASUlocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Bronx, US	1
EL PASO, US	1
Durham, US	1
Fort Hayslocation not on record	1
Madison, US	1
Santa Barbara, US	1

11 institutions · 40 of 47 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Xanthoparmelia idahoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)