Xanthoparmelia ajoensis — The Life Data

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Parmeliaceae/Xanthoparmelia

At a glance

Occurrence records114

Data sources4

Biological traits1

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Xanthoparmelia ajoensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility114 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF114 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthoparmelia ajoensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH580218.1 ↗495 bpMexico

ACGT

CCGAGAGAGGGGCTTCGTGCTCCCGGGGGTTTCGGCCCCCTAATTCTTCACCCTTTGCGTACCTACCTTTGTTGCTTTGGCGGGCCCGAG …

Xanthoparmelia ajoensis isolate 14908 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type114 records

Museum / vouchered114

Range

Area of Occupancy AOO204 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 2≤1 km 22≤10 km 3

27 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence114

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	50
Chicago, US	23
Madison, US	19
St. Paul, US	7
Olocation not on record	3
Mexico City, MX	2
Logan, US	2
Durham, US	2
University of Stellenboschlocation not on record	1
Santa Barbara, US	1
Helsinki, FI	1
Stockholm, SE	1
Boise, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1

14 institutions · 114 of 114 vouchered records shown