Xanthoconium purpureum

Snell & E.A.Dick · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Xanthoconium

At a glance

Occurrence records387

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Xanthoconium purpureum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility387 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF387 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈71 Mbp

01Narrative

Xanthoconium purpureum is a species of bolete fungus in the genus Xanthoconium. It was described as new to science in 1962 by Wally Snell and Esther Dick in 1962. It is found in eastern North America, where it fruits under oak, sometimes in oak-pine forests.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthoconium purpureum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ258859.1 ↗555 bpUSA · 2015

ACGT

CATTATCGAACACACAAAAGGACTGTCGCTGGCTTCGGCATGTGCACGTCTTTTTATCACACCCACACCCGTGCACCTTCTGTAGGCCCT …

Xanthoconium purpureum voucher NY2449667 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Xanthoconium purpureum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈70 831 614 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Xanthoconium purpureum0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type387 records

Wild obs. + sensor330

Museum / vouchered57

Range

Area of Occupancy AOO1 188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 109≤1 km 49≤10 km 57>10 km 36

251 georeferenced · 79 without coordinates

Open the mapobservation + sensor330

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤1 km 6≤10 km 11

17 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Davis and Elkins Collegelocation not on record	18
Bronx, US	12
Chicago, US	11
TENN-Flocation not on record	6
Durham, US	3
St. Paul, US	2
WTUlocation not on record	1
Ann Arbor, US	1
Toronto, CA	1
Baton Rouge, US	1

10 institutions · 56 of 57 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)