Xanthoconium affine

(Peck) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Xanthoconium

At a glance

Occurrence records990

Data sources8

Biological traits0

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Xanthoconium affine's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility990 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.07 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF990 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT74 Mbp

01Narrative

Xanthoconium affine is a species of edible bolete fungus of the genus Xanthoconium. First described as a species of Boletus by Charles Horton Peck in 1873, it was placed in its current genus by Rolf Singer in 1944.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Xanthoconium affine has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries4

The DNA barcodea real sequence read deposited for this species

ITSKY826122.1 ↗510 bpCanada · 1999

ACGT

CGCTGGCTTCGGCATGTGCACGTTCTTTTCTCTCACTCACACTTGTGCACCATCTGTAGGCCCTTGAAAGAGGACCTATGTTTTCCATTC …

Xanthoconium affine voucher CMMF003328 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Xanthoconium affine carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size74 190 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Xanthoconium affine0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type990 records

Wild obs. + sensor803

Museum / vouchered187

Range

Area of Occupancy AOO2 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 301≤1 km 102≤10 km 140>10 km 77

620 georeferenced · 183 without coordinates

Open the mapobservation + sensor803

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 7≤1 km 9≤10 km 35>10 km 2

53 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence187

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	71
Acadia Universitylocation not on record	20
Université de Montréal Biodiversity Centrelocation not on record	12
FLASlocation not on record	11
St. Paul, US	11
Chicago, US	9
Davis and Elkins Collegelocation not on record	7
Bernard Price Institute for Palaeontological Researchlocation not on record	7
TENN-Flocation not on record	6
ILLSlocation not on record	4
Colorado State Universitylocation not on record	4
Durham, US	3
National Institute of Biological Resourceslocation not on record	3
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	3
Osaka, JP	2
WTUlocation not on record	2
Chiba, JP	2
Tomioka, JP	2
Toronto, CA	2
Chapel Hill, US	1
Ann Arbor, US	1
Tampa, US	1
Cincinnati, US	1
Durango, MX	1
Valdosta State Universitylocation not on record	1

25 institutions · 187 of 187 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)