Woldmaria filicina

(Peck) Knudsen · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Niaceae/Woldmaria

At a glance

Occurrence records454

Data sources9

Biological traits0

DNA specimens1

eDNA detections3

Sources9 archives

Databases and archives Woldmaria filicina's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility454 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF454 records

Environmental DNA2 datasets · 3 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Woldmaria is a fungal genus in the family Niaceae. The genus is monotypic, containing the single species Woldmaria filicina, found in Europe and North America. Woldmaria was described by William Bridge Cooke in 1961, with Woldmaria crocea as the type species; it was subsequently moved into synonymy with W. filicina.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Woldmaria filicina has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP831630.1 ↗670 bpUSA · 2021

ACGT

GAAAGTGAACCTGCGGAAGGATCATTATTGAAGTCATAAAGCTGGGTTGTAGCTGGCCTTTTTGGAGGCATGTGCACGCTGAGCTCTTGT …

Woldmaria filicina isolate MO465010 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type454 records

Wild obs. + sensor298

Museum / vouchered146

Other10

Range

Area of Occupancy AOO1 156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 228≤1 km 41≤10 km 6>10 km 2

277 georeferenced · 21 without coordinates

Open the mapobservation + sensor298

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 26≤1 km 69≤10 km 22>10 km 1

118 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	57
Salzburg, AT	14
TROMlocation not on record	8
SLU Artdatabankenlocation not on record	8
Helsinki, FI	6
Toronto, CA	6
Trondheim, NO	6
Philadelphia, US	4
nsnflocation not on record	3
Copenhagen, DK	3
Oulu, FI	2
Trondheim, NO	2
WU-MYClocation not on record	2
Acadia Universitylocation not on record	1
Kuopio, FI	1
University of Oslo, Natural History Museumlocation not on record	1
Göteborg, SE	1
Karlsruhe, DE	1
LDlocation not on record	1

19 institutions · 127 of 146 vouchered records shown · 19 without an institution code

09Environmental DNA3 detections

Where the DNA of Woldmaria filicina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map3 countries0

PalearcticIndomalayan

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 9.00–17.1

Seasonal swing summer↔winter18.9 °C

Max temp (day)19.2 °C 10.7–20.8

Min temp (night)11.7 °C 7.00–12.7

Precipitation79.0 mm/mo 59.4–87.6

Air humidity63.5 % 61.1–63.6

Moisture balance-13.9 mm/mo -21.8–-8.80

Vapour deficit718 Pa 476–730

Wind speed2.80 m/s 1.70–5.90

Cloud cover44.1 % 36.2–45.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)