Willdenowia incurvata

(Thunb.) H.P.Linder · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Restionaceae/Willdenowia

At a glance

Occurrence records569

Data sources7

Biological traits18

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Willdenowia incurvata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility569 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF569 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Willdenowia incurvata is a species of flowering plant in the genus Willdenowia endemic to the Fynbos region of the Northern Cape and Western Cape. It is also known as the sonqua sunreed; or sonkwasriet in Afrikaans.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max2 m

Plant height min0.34 m

Seed mass122 mg

⚠ sources differ — TRY: 122 mg · GIFT: 78.8 mg

Seed mass max143 mg

Seed mass min35.8 mg

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 525 m

Elevation min10 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Willdenowia incurvata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKP110509.1 ↗552 bpSouth Africa · 2012

ACGT

AGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCAGCA …

Willdenowia incurvata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa

plant barcode

08Occurrence & distribution

Record type569 records

Wild obs. + sensor407

Museum / vouchered162

Range

Area of Occupancy AOO1 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 296≤1 km 35≤10 km 9>10 km 10

350 georeferenced · 57 without coordinates

Open the mapobservation + sensor407

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 2>10 km 2

5 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	68
Cape Town, ZA	66
Cape Town, ZA	12
Bronx, US	3
Zürich, CH	3
Moscow State Universitylocation not on record	2
MSB-3054location not on record	2
South African Environmental Observations Networklocation not on record	1
CASlocation not on record	1
South African National Biodiversity Institutelocation not on record	1
GHPG$location not on record	1

11 institutions · 160 of 162 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Willdenowia incurvata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 11.2–11.2

Seasonal swing summer↔winter13.0 °C

Max temp (day)17.2 °C

Min temp (night)6.20 °C

Precipitation56.5 mm/mo

Air humidity55.7 %

Moisture balance-10.0 mm/mo

Vapour deficit592 Pa

Wind speed3.20 m/s

Cloud cover5.00 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)