Westermannia gloriosa

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nolidae/Westermannia

At a glance

Occurrence records136

Data sources5

Biological traits0

DNA specimens18

eDNA detections18

Sources5 archives

Databases and archives Westermannia gloriosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF136 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD18 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Westermannia gloriosa has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections18

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

38Gmostly conserved

50Tmostly conserved

88Amostly conserved

130Amostly conserved

637Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACATCTTTAAGTCTCTTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.09%

Haplotypes5

BIN1

Most divergent pair0.30%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Westermannia superbasame genus4.8%Schinia hulstiasame order6.1%Melese klagesisame order6.2%Schinia argentifasciasame order6.2%Catadoides punctatasame order6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type136 records

Wild obs. + sensor123

Museum / vouchered13

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 60≤1 km 33≤10 km 6>10 km 10

109 georeferenced · 14 without coordinates

Open the mapobservation + sensor123

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	8
Museums Victorialocation not on record	2

2 institutions · 10 of 13 vouchered records shown · 3 without an institution code

09Environmental DNA18 detections

Where the DNA of Westermannia gloriosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 20.4–25.6

Seasonal swing summer↔winter7.00 °C

Max temp (day)25.5 °C 24.5–28.9

Min temp (night)18.3 °C 16.3–23.3

Precipitation145 mm/mo 39.7–226

Air humidity64.5 % 59.3–69.9

Moisture balance15.0 mm/mo -61.2–138

Vapour deficit949 Pa 758–1,188

Wind speed1.50 m/s 1.20–4.10

Cloud cover41.8 % 31.6–49.3

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)