Wallemia sebi

(Fr.) Arx · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Wallemiomycetes/Wallemiales/Wallemiaceae/Wallemia

At a glance

Occurrence records3 636

Data sources11

Biological traits0

DNA specimens42

eDNA detections1 727

Sources11 archives

Databases and archives Wallemia sebi's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 079 records↗

OBISOcean Biodiversity Information System1 557 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 727 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF · OBIS3 636 records

Environmental DNA9 datasets · 29 countries1 727 detections

DNA & barcodingBOLD · NCBI42 specimens

01Narrative

Wallemia sebi is a xerophilic fungus of the phylum Basidiomycota. It is commonly found on highly sugared or salted materials, such as jams, bread, cakes, sugar, bacon, salted meats, and salted fish. It is also found in indoor air, house dust, and soil. One distinctive feature of W. sebi is its relationship with water activity. Most fungi are profoundly affected by the availability of water. The ability to tolerate environments with low water activity has been found mostly in Ascomycota, but rarely in Basidiomycota. However, W. sebi. can adjust its morphology and physiology to adapt to different environmental conditions and survive osmotic stress. Wallemia sebi have lower limits for growth below water activity of 0.75 (0.69-0.75)aw, while most microorganisms are limited to 0.95 and above. Wallemia sebi has been isolated from hair, hay, textiles and man. It can grow slowly without additional solute in the growth medium, and form small, reddish-brown, powdery colonies.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition18 compounds

Compounds documented for Wallemia sebi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Caryophyllane sesquiterpenoids3

Simple indole alkaloids2

Pyridine alkaloids2

pteridine alkaloids1

Cholestane steroids $ Ergostane steroids1

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3R,4Z,6R,9R)-4,11,11-trimethyl-8-methylidenebicyclo[7.2.0]undec-4-ene-3,6-diol	present	LOTUS
(2r,3s)-1-(4-Hydroxyphenyl)butane-2,3-diol	present	LOTUS
(2s,3s)-1-(4-Hydroxyphenyl)butane-2,3-diol	present	LOTUS
(5R)-3-hydroxy-5-methyl-5,6-dihydrocyclopenta[b]pyridin-7-one	present	LOTUS
(s)-3-Hydroxy-4-(4-hydroxyphenyl)butan-2-one	present	LOTUS
2,5-Furandimethanol	present	LOTUS
3-Hydroxy-5-methylpyridine	present	LOTUS
3-Methylfuran	present	LOTUS
4-Methylfuran-2-carboxylic acid	present	LOTUS
5-Hydroxy-2,3-dihydro-1-benzofuran-3-one	present	LOTUS

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Wallemia sebi has left across the world's sequence archives.

At a glance

DNA specimens42

Marker genes4

GenBank sequences10

eDNA detections1 727

Countries29

The DNA barcodea real sequence read deposited for this species

ITSPV945511.1 ↗475 bpArgentina · 2024

ACGT

CACCCTCGTTTTAAAAATAGTTTACTAGAATGTCCAAGCAGTTAAGCTGTTGAAATATTAAAAGTTTAATAAAACTTTCAGCAACGGATC …

Wallemia sebi isolate NDM_4520 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

07Deep time~312 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin312 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type3 636 records

Wild obs. + sensor12

Museum / vouchered3 623

Cultivated / captive1

Range

Area of Occupancy AOO1 660 km²

Depth

0–200 m sunlit1 216

200–1000 m twilight46

1–4 km midnight0

>4 km abyssal0

median 10 m · max 800 m · 1 262 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 4≤10 km 5>10 km 3

12 georeferenced

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 2≤10 km 2>10 km 3

7 georeferenced · 3 616 without coordinates

Open the institutions mapphysical evidence3 623

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	2
TROMlocation not on record	1
Scientific Institute of Public Health, Brusselslocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Uppsala, SE	1
Catholic University of Pekinglocation not on record	1

7 institutions · 8 of 3 623 vouchered records shown · 2 057 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 727 detections

Where the DNA of Wallemia sebi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 727

Studies independent surveys9

Countries29

Verifiable raw sequence linked1 081

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 727 detections have coordinates

Open the map29 countries0

dust in house a dilution to extinctionConiferous forestTreed pine-dwarfshrubs-sphagnum ombrotrophic…Birch sphagnum forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature21.0 °C 9.00–40.0

pH6.80 3.60–9.10

Conductivity122 µS/cm 10.0–126,900

Organic carbon1.13 % 0.004–13.8

Water content7.78 % 0.414–117

Nitrate-N6.30 mg/kg 0.5–390

Phosphorus18.0 mg/kg 2.00–811

Clay20.2 % 0.94–75.9

Sand62.5 % 0–99.1

Depth0 m 0–0.2

SoilNoneMarineVertosolCalcarosolVertosolsPodosolTenosolKurosol

310 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 7.70–21.3

Seasonal swing summer↔winter9.40 °C

Max temp (day)16.0 °C 9.10–27.0

Min temp (night)9.90 °C 5.50–16.0

Precipitation78.0 mm/mo 33.2–143

Air humidity64.2 % 54.6–65.2

Vapour deficit590 Pa 368–1,015

Cloud cover56.1 % 19.0–65.3

CHELSA 1981–2010, ~9 km grid, at location & month of 1 690 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Wallemia sebi

At a glance

Sources11 archives

Compound class profile5 classes

Documented compounds18 total

At a glance

At a glance

When this lineage existed

Record type3 636 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions1 of 7 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type3 636 records