Waitzia suaveolens

(Benth.) Druce · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Waitzia

At a glance

Occurrence records226

Data sources8

Biological traits25

DNA specimens1

eDNA detections2

Sources8 archives

Databases and archives Waitzia suaveolens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility226 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF226 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Waitzia suaveolens, commonly known as fragrant waitzia, is an annual herb in the family Asteraceae. It is endemic to the south-west of Western Australia. Plants grows to 0.6 metres in height and flower between September and January. The species was first formally described in 1837 and named Leptorhynchus suaveolens by English botanist George Bentham based on plant material collected from the Swan River region. It was subsequently placed in the genus Waitzia in 1917. Two varieties are currently recognised: Waitzia suaveolens var. flava Paul G.Wilson Waitzia suaveolens (Benth.) Druce var. suaveolens

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology7

Leaf length44 mm

Leaf width3.5 mm

Plant height0.5 m

Plant height max0.6 m

Seed mass0.15 mg

⚠ sources differ — TRY: 0.15 mg · AusTraits: 0.13 mg · GIFT: 0.137 mg

Seed mass max0.23 mg

Seed mass min0.1 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timeynnnnnnnyyyy

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapeobovate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Waitzia suaveolens has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSKM508032.1 ↗410 bp

ACGT

GCATCGATGAAGAACGCAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCA …

Waitzia suaveolens var. flava isolate ASL1215 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type226 records

Wild obs. + sensor112

Museum / vouchered114

Origin

Native1

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 31≤1 km 62≤10 km 6>10 km 4

103 georeferenced · 9 without coordinates

Open the mapobservation + sensor112

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 13≤1 km 5≤10 km 53>10 km 10

81 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence114

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	56
Museo Entomologico de Leonlocation not on record	42
Claremont, US	4
LDlocation not on record	4
Adelaide, AU	2
BGPAlocation not on record	2
Joondalup, AU	1
Hobart, AU	1
Mount Annan, AU	1
Wlocation not on record	1

10 institutions · 114 of 114 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Waitzia suaveolens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)