Waitzia acuminata

Steetz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Waitzia

At a glance

Occurrence records1 158

Data sources12

Biological traits37

DNA specimens3

eDNA detections4

Sources12 archives

Databases and archives Waitzia acuminata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 158 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources37 traits

Chemical compositionLOTUS · NPASS55 compounds

Occurrence & distributionGBIF1 158 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Waitzia acuminata, commonly known as orange immortelle, is an annual forb in the family Asteraceae. It is native to Australia. Plants grow to between 10 and 60 cm in height and have leaves that are long and narrow. These are between 2 and 7 cm long and 2 to 5 mm in width. The yellow, orange or white flowers appear between July and January. Waitzia Acuminata occurs in all mainland states of Australia and is currently not considered rare or endangered. Its genus Waitzia is named after German botanist Karl Friedrich Waitz. Acuminata is a latin name describing things that are tapered to a point, named after the plants spindle like outer bracts. The species was first formally described in 1845 by German botanist Joachim Steetz in Plantae Preissianae. Two varieties are currently recognised: Waitzia acuminata Steetz var. acuminata Waitzia acuminata var. albicans Paul G.Wilson

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology16

Fruit length3 mm

Leaf length45 mm

Leaf length max100 mm

Leaf length min20 mm

Leaf mass per area196 g/m2

Leaf width3.5 mm

Leaf width max5 mm

Leaf width min2 mm

Plant height0.303 m

⚠ sources differ — AusTraits: 0.303 m · TRY: 0.33 m

Plant height max0.6 m

Plant height min0.1 m

Seed length1.16 mm

Seed mass0.24 mg

⚠ sources differ — TRY: 0.24 mg · AusTraits: 0.262 mg · GIFT: 0.255 mg

Seed mass max0.32 mg

Seed mass min0.19 mg

Seed width0.32 mm

Life cycle & reproduction8

Dehiscenceindehiscent

Dispersal typewind

Flowering timennnnnnnnyyyn

Life spanannual

Pollination syndromeinsect

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Leaf compoundnesssimple

Leaf shapenarrowly_oblanceolate narrowly_oblong oblong

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition55 compounds

Compounds documented for Waitzia acuminata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Labdane diterpenoids18

Pimarane and Isopimarane diterpenoids4

Abietane diterpenoids4

Menthane monoterpenoids $ Monocyclic monoterpenoids3

Aromadendrane sesquiterpenoids3

Documented compounds55 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Nortrachelogenin	present	NPASS
(-)-alpha-Fenchol	present	NPASS
(-)-Epicatechin-4beta-benzylthioether	present	NPASS
(1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	LOTUS
(2R,3S,4aR,8S,8aS)-8-[(3R)-3-hydroxy-3-methylpent-4-enyl]-4,4,7,8a-tetramethyl-1,2,3,4a,5,8-hexahydronaphthalene-2,3-diol	present	LOTUS
(2R,4aR,5S,8aR)-5-[(3R)-3-hydroxy-3-methylpent-4-enyl]-1,1,4a,6-tetramethyl-2,3,4,5,8,8a-hexahydronaphthalen-2-ol	present	LOTUS
(2R,4aR,5S,8aS)-5-[(3R)-3-hydroxy-3-methylpent-4-enyl]-1,1,4a,6-tetramethyl-2,3,4,5,8,8a-hexahydronaphthalen-2-ol	present	LOTUS
(2S,4aS,8S,8aR)-8-[(3R)-3-hydroxy-3-methylpent-4-enyl]-4,4,7,8a-tetramethyl-1,2,3,4a,5,8-hexahydronaphthalen-2-ol	present	LOTUS
(2S,4aS,8S,8aS)-8-[(3R)-3-hydroxy-3-methylpent-4-enyl]-4,4,7,8a-tetramethyl-1,2,3,4a,5,8-hexahydronaphthalen-2-ol	present	LOTUS
(4aS,4bR,6S,8aS)-6-hydroxy-4b,8,8-trimethyl-3,4,4a,5,6,7,8a,9-octahydro-1H-phenanthren-2-one	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Waitzia acuminata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences8

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSAB033323.1 ↗639 bp

ACGT

TCGAACCCTGCACAGCAGAACGACCCGTGAACATGTAACTACTATCGGGCAACGTGGGGATCGAGCTTTCGTTAGATCCTTAGTTCCCAT …

Waitzia acuminata var. albicans gene for ITS1, 5.8S ribosomal RNA, ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Waitzia acuminata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Watanabe, K., P. S. Short, T. Denda, N. Konishi, M. Ito & K. Kosuge. 1999. Asteraceae: chromosome numbers and karyotypes in the Australian Gnaphalieae and Plucheeae. Austral. Syst. Bot. 12: 781–802.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

07Deep time~1.89 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.89 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 158 records

Wild obs. + sensor922

Museum / vouchered233

Cultivated / captive3

Origin

Native22

Range

Area of Occupancy AOO3 344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 681≤1 km 62≤10 km 56>10 km 47

846 georeferenced · 76 without coordinates

Open the mapobservation + sensor922

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 82≤1 km 25≤10 km 52>10 km 7

166 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence233

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	115
Palmerston, AU	15
Mount Annan, AU	14
Adelaide, AU	14
Stockholm, SE	13
Hobart, AU	12
Museo Entomologico de Leonlocation not on record	8
Joondalup, AU	5
EL PASO, US	3
Canberra, AU	3
Claremont, US	3
Brisbane, AU	3
University of Stellenboschlocation not on record	3
MeiseBGlocation not on record	2
NSW Dept of Planning, Industry and Environmentlocation not on record	2
Parkville, AU	2
La Trobe Universitylocation not on record	2
Christchurch, NZ	1
Armidale, AU	1
Guangzhou, CN	1
GB	1
John T. Waterhouse Herbariumlocation not on record	1
Uppsala, SE	1
South Kensington, GB	1
Beijing, CN	1
LDlocation not on record	1
Smithfield, AU	1

27 institutions · 229 of 233 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Waitzia acuminata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Waitzia acuminata

At a glance

Sources12 archives

Size & morphology16

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds55 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type1 158 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 158 records