Waireia stenopetala

(Hook.f.) D.L.Jones, M.A.Clem. & Molloy · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Waireia

At a glance

Occurrence records537

Data sources8

Biological traits22

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Waireia stenopetala's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility537 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF537 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 46

01Narrative

Waireia is een monotypisch geslacht uit de orchideeënfamilie, onderfamilie Orchidoideae. De enige soort van dit geslacht, Waireia stenopetala, is een terrestrische orchidee afkomstig uit de gematigde, montane gebieden van Nieuw-Zeeland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length max150 mm

Leaf width20 mm

Leaf width max20 mm

Leaf width min20 mm

Plant height0.24 m

Plant height max0.4 m

Life cycle & reproduction8

Deciduousnessdeciduous

Dispersal typewind

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Waireia stenopetala has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF348072.1 ↗707 bp

ACGT

ATCATTGTTGAGTCCCGAAAGAGACCGAGCAATTTTGACAACCTGTGAATTAAATATGGGGGGCGGCGGAACCTGCTGTTGCCCATTCAC …

Waireia stenopetala 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Waireia stenopetala carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Ploidypolyploid inferred

Chromosome records40–462n range43median46mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · new-zealand

CCDB · new-zealand

2n 461×CCDB · new-zealand

CCDB · new-zealand

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type537 records

Wild obs. + sensor328

Museum / vouchered209

Range

Area of Occupancy AOO956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 158≤1 km 68≤10 km 30>10 km 17

273 georeferenced · 55 without coordinates

Open the mapobservation + sensor328

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 4≤10 km 4

8 georeferenced · 201 without coordinates

Open the institutions mapphysical evidence209

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	119
Wellington, NZ	53
Auckland, NZ	29
Rotorua, NZ	2
South Kensington, GB	2
Hobart, AU	1
Museo Entomologico de Leonlocation not on record	1
Smithfield, AU	1
Canberra, AU	1

9 institutions · 209 of 209 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Waireia stenopetala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)