Wahlenbergia multicaulis

Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Campanulaceae/Wahlenbergia

At a glance

Occurrence records2 530

Data sources8

Biological traits43

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Wahlenbergia multicaulis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 530 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF2 530 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaTgenome

01Narrative

Wahlenbergia multicaulis is a small herbaceous plant in the family Campanulaceae native to Australia (all states except Queensland and the Northern Territory). The slender, erect to ascending perennial herb typically grows to a height of 0.2 to. It blooms between September and February producing blue flowers. In Western Australia, the species is found on the edges of swamps and creek beds and on hillsides in the Wheatbelt and South West regions where it grows in sandy-loamy-clay soils over granite or laterite.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology18

Fruit length8.25 mm

Fruit width2.75 mm

Leaf length42.5 mm

Leaf length max80 mm

Leaf length min4 mm

Leaf mass per area22.59 g/m2

Leaf size332 mm²

Leaf width3.5 mm

Leaf width max6 mm

Leaf width min1 mm

Plant height0.705 m

Plant height max0.75 m

Plant height min0.1 m

Seed length0.4 mm

Seed mass0.01 mg

⚠ sources differ — TRY: 0.01 mg · AusTraits: 0.013 mg · GIFT: 0.01 mg

Seed mass max0.01 mg

Seed mass min0.01 mg

Seed width0.2 mm

Life cycle & reproduction11

Dehiscencedehiscent

Dispersal typeself

Flowering timeyynnnnnnyyyy

Life formperennial

Life span>15

⚠ sources differ — TRY: >15 · AusTraits: perennial · GIFT: perennial

Lifespan years15 years

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproductive maturity1.83 years

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelinear oblanceolate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Wahlenbergia multicaulis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN379875.1 ↗583 bpAustralia

ACGT

GTTGAAAAACACATTCGGGGCGGGGGAAAGCTCGCGCGGACCCTCCCCCTCCAAAAACGAACCCCGGCGCGATCCGCGCCAAGGAAAACT …

Wahlenbergia multicaulis voucher Prebble 0931 WELT 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Wahlenbergia multicaulis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 530 records

Wild obs. + sensor1 980

Museum / vouchered549

Cultivated / captive1

Origin

Native123

Introduced1

Range

Area of Occupancy AOO7 144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 1 147≤1 km 516≤10 km 188>10 km 7

1 858 georeferenced · 122 without coordinates

Open the mapobservation + sensor1 980

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 32≤1 km 171≤10 km 265>10 km 30

498 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence549

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	169
Canberra, AU	93
Hobart, AU	73
Adelaide, AU	72
Mount Annan, AU	50
Kensington, AU	40
NSW Dept of Planning, Industry and Environmentlocation not on record	13
Wollongong, AU	11
Wellington, NZ	7
QVMAGlocation not on record	7
Brisbane, AU	3
Auckland, NZ	2
Stockholm, SE	1
Armidale, AU	1
BGPAlocation not on record	1
La Trobe Universitylocation not on record	1

16 institutions · 544 of 549 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Wahlenbergia multicaulis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Wahlenbergia multicaulis

At a glance

Sources8 archives

Size & morphology18

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 530 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 530 records