Wahlenbergia gracilis

(G.Forst.) A.DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Campanulaceae/Wahlenbergia

At a glance

Occurrence records13 669

Data sources10

Biological traits49

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Wahlenbergia gracilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 669 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources49 traits

Occurrence & distributionGBIF13 669 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GIFT2n = 18

01Narrative

Wahlenbergia quadrifida là loài thực vật có hoa trong họ Hoa chuông. Loài này được (R.Br.) A.DC. miêu tả khoa học đầu tiên năm 1830.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology21

Fruit length4.75 mm

⚠ sources differ — AusTraits: 4.75 mm · GIFT: 8 mm

Fruit length max10 mm

Fruit length min6 mm

Fruit width2.5 mm

Leaf length40 mm

Leaf length max60 mm

Leaf length min2 mm

Leaf size243 mm²

Leaf width5.5 mm

⚠ sources differ — AusTraits: 5.5 mm · GIFT: 5 mm

Leaf width max10 mm

Leaf width min0.2 mm

Plant height0.5 m

Plant height max0.8 m

Plant height min0.05 m

Seed length0.614 mm

Seed length max0.6 mm

Seed length min0.6 mm

Seed mass0.022 mg

⚠ sources differ — TRY: 0.022 mg · AusTraits: 0.016 mg · GIFT: 0.034 mg

Seed mass max0.26 mg

Seed mass min0 mg

Seed width0.297 mm

Life cycle & reproduction10

Dehiscencedehiscent

Dispersal typewind

Flowering timennnnnnnnnnnn

Life formsubshrub

Life spanperennial

Pollination syndromeinsect

Raunkiær life formchamaephyte

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max800 m

Elevation min35 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTSavanna, dense secondary shrub and ruderal vegetation

Leaf compoundnesssimple

Leaf shapelinear oblanceolate obovate

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)25.6 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Wahlenbergia gracilis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ823445.1 ↗572 bpAustralia

ACGT

CTGCACAGCAAACGACCCGCGAACACGTTGAAAAACACATTCGGGGCGTGGGGAAACCCCCCTCCCATAACGAACCCCGGCGCGATCCGC …

Wahlenbergia gracilis 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB · GIFT

The complete instruction manual Wahlenbergia gracilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome records18–642n range54median18mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · GIFT · GIFT (floras)

CCDB · ipcn-api-dl — Gulline, H. F. 2003. <In> R. J. E. Wiltshire & W. D. Jackson, Index of chromosome numbers of Tasmanian spermatophytes. Pap. & Proc. Roy. Soc. Tasmania 137: 39–53.

CCDB · book-ipcn67-71 — HSU, C.-c. 1967. Preliminary chromosome studies on the vascular plants of Taiwan (I). Taiwania No. 13: 117-130.

GIFT · GIFT (floras)

2n 643×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants · GIFT · GIFT (floras)

CCDB · book-fedorov — Sugiura 1942b

CCDB · book-atlas-flowering-plants — Sugiura 1942

GIFT · GIFT (floras)

2n 542×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Gulline (D. 1955)

CCDB · book-atlas-flowering-plants

2n 361×GIFT · GIFT (floras)

GIFT · GIFT (floras)

n 272×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Smith, P. J. 1992. A revision of the genus Wahlenbergia (Campanulaceae) in Australia. Telopea 5: 91–175.

CCDB · ipcn-api-dl — Petterson, J. A., E. G. Williams & M. I. Dawson. 1995. Contributions to a chromosome atlas of the New Zealand flora---34. Wahlenbergia (Campanulaceae). New Zealand J. Bot. 33: 489–496.

n 181×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — HSU, C.-C. 1968. Preliminary chromosome studies on the vascular plants of Taiwan (II). Taiwania No. 14: 11-27.

n 361×CCDB · ipcn-api-dl

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type13 669 records

Wild obs. + sensor12 209

Museum / vouchered1 307

Cultivated / captive5

Other148

Origin

Native276

Range

Area of Occupancy AOO33 196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 9 836≤1 km 1 757≤10 km 377>10 km 56

12 026 georeferenced · 183 without coordinates

Open the mapobservation + sensor12 209

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 348≤1 km 247≤10 km 441>10 km 78

1 114 georeferenced · 193 without coordinates

Open the institutions mapphysical evidence1 307

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 3 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	285
Mount Annan, AU	194
Museo Entomologico de Leonlocation not on record	173
Canberra, AU	156
NSW Dept of Planning, Industry and Environmentlocation not on record	89
Hobart, AU	78
Adelaide, AU	44
Armidale, AU	42
Christchurch, NZ	34
NSW Office of Environment and Heritagelocation not on record	27
Wellington, NZ	25
Wollongong, AU	21
Paris, FR	14
James Cook Townsvillelocation not on record	14
BISHlocation not on record	13
John T. Waterhouse Herbariumlocation not on record	12
Taipei, TW	11
Auckland, NZ	9
Smithfield, AU	8
Batemans Bay, AU	6
Zürich, CH	5
Nanjing, CN	5
QVMAGlocation not on record	5
Honolulu, US	4
Palmerston, AU	3
China Agricultural Universitylocation not on record	3
Nagasaki University - Fisherieslocation not on record	3
Kew, GB	3
Shanghai, CN	2
Palmerston North, NZ	2
La Trobe Universitylocation not on record	2
Nanjing, CN	2
Awka, NG	2
Norfolk, US	1
Cambridge University Herbariumlocation not on record	1
Université de Strasbourglocation not on record	1
HAWlocation not on record	1
Chicago, US	1
Stockholm, SE	1
Moscow, US	1
MAlocation not on record	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
LDlocation not on record	1

43 institutions · 1 306 of 1 307 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Wahlenbergia gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Wahlenbergia gracilis

At a glance

Sources10 archives

Size & morphology21

Life cycle & reproduction10

Diet & foraging1

Habitat & environment13

Physiology & chemistry3

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type13 669 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions27 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type13 669 records