Vriesea vagans

(L.B.Sm.) L.B.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Vriesea

At a glance

Occurrence records396

Data sources7

Biological traits12

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Vriesea vagans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility396 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF396 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Vriesea vagans is a plant species in the genus Vriesea. The bromeliad is endemic to the Atlantic Forest biome (Mata Atlantica Brasileira), located in southeastern Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 400 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTÁrea Antrópica, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vriesea vagans has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJN202202.1 ↗632 bp

ACGT

TACAAATTGACTTATTATACTCCTGACTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCG …

Vriesea vagans ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3

plant barcode

08Occurrence & distribution

Record type396 records

Wild obs. + sensor135

Museum / vouchered260

Other1

Origin

Native131

Range

Area of Occupancy AOO780 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 65≤1 km 24≤10 km 5>10 km 13

107 georeferenced · 28 without coordinates

Open the mapobservation + sensor135

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 259 without coordinates

Open the institutions mapphysical evidence260

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	134
INMAlocation not on record	15
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	12
Santa Teresa, BR	11
San Jose State University, Museum of Birds and Mammalslocation not on record	8
University of Stellenboschlocation not on record	7
UNESClocation not on record	7
Criciúma, BR	7
Bronx, US	6
Pontifícia Universidade Católica do Paranálocation not on record	5
Porto Alegre, BR	5
UFESlocation not on record	4
Ivano-Frankivsk, UA	4
UNESP-RClocation not on record	4
Federal University of Espírito Santolocation not on record	4
JBRJlocation not on record	3
UFPRlocation not on record	3
Universidade Federale do Rio Grande do Sullocation not on record	2
UNICAMPlocation not on record	2
UNIVILLElocation not on record	2
Universidade Federal do Rio Grande do Nortelocation not on record	2
UFMGlocation not on record	2
UFRRJlocation not on record	1
UNISANTAlocation not on record	1
IAPlocation not on record	1
Departamento de Geologia, Universidad de Chilelocation not on record	1
IPA/SPlocation not on record	1
CEPLAClocation not on record	1
Universidade Federal do Espírito Santolocation not on record	1
FUVATESlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Entomological Society of Latvialocation not on record	1

32 institutions · 259 of 260 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Vriesea vagans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)